NCBI C++ ToolKit
|
Search Toolkit Book for CDense_seg_Base
Dense-seg: the densist packing for sequence alignments only. More...
#include <objects/seqalign/Dense_seg_.hpp>
Public Types | |
enum class | E_memberIndex { e__allMandatory = 0 , e_dim , e_numseg , e_ids , e_starts , e_lens , e_strands , e_scores } |
typedef int | TDim |
typedef int | TNumseg |
typedef vector< CRef< CSeq_id > > | TIds |
typedef vector< TSignedSeqPos > | TStarts |
typedef vector< TSeqPos > | TLens |
typedef vector< ENa_strand > | TStrands |
typedef vector< CRef< CScore > > | TScores |
typedef Tparent::CMemberIndex< E_memberIndex, 8 > | TmemberIndex |
Public Types inherited from CObject | |
enum | EAllocFillMode { eAllocFillNone = 1 , eAllocFillZero , eAllocFillPattern } |
Control filling of newly allocated memory. More... | |
typedef CObjectCounterLocker | TLockerType |
Default locker type for CRef. More... | |
typedef atomic< Uint8 > | TCounter |
Counter type is CAtomiCounter. More... | |
typedef Uint8 | TCount |
Alias for value type of counter. More... | |
Public Member Functions | |
CDense_seg_Base (void) | |
virtual | ~CDense_seg_Base (void) |
DECLARE_INTERNAL_TYPE_INFO () | |
bool | IsSetDim (void) const |
dimensionality Check if a value has been assigned to Dim data member. More... | |
bool | CanGetDim (void) const |
Check if it is safe to call GetDim method. More... | |
void | ResetDim (void) |
Reset Dim data member. More... | |
void | SetDefaultDim (void) |
Assign default value to Dim data member. More... | |
TDim | GetDim (void) const |
Get the Dim member data. More... | |
void | SetDim (TDim value) |
Assign a value to Dim data member. More... | |
TDim & | SetDim (void) |
Assign a value to Dim data member. More... | |
bool | IsSetNumseg (void) const |
number of segments here Check if a value has been assigned to Numseg data member. More... | |
bool | CanGetNumseg (void) const |
Check if it is safe to call GetNumseg method. More... | |
void | ResetNumseg (void) |
Reset Numseg data member. More... | |
TNumseg | GetNumseg (void) const |
Get the Numseg member data. More... | |
void | SetNumseg (TNumseg value) |
Assign a value to Numseg data member. More... | |
TNumseg & | SetNumseg (void) |
Assign a value to Numseg data member. More... | |
bool | IsSetIds (void) const |
sequences in order Check if a value has been assigned to Ids data member. More... | |
bool | CanGetIds (void) const |
Check if it is safe to call GetIds method. More... | |
void | ResetIds (void) |
Reset Ids data member. More... | |
const TIds & | GetIds (void) const |
Get the Ids member data. More... | |
TIds & | SetIds (void) |
Assign a value to Ids data member. More... | |
bool | IsSetStarts (void) const |
start OFFSETS in ids order within segs Check if a value has been assigned to Starts data member. More... | |
bool | CanGetStarts (void) const |
Check if it is safe to call GetStarts method. More... | |
void | ResetStarts (void) |
Reset Starts data member. More... | |
const TStarts & | GetStarts (void) const |
Get the Starts member data. More... | |
TStarts & | SetStarts (void) |
Assign a value to Starts data member. More... | |
bool | IsSetLens (void) const |
lengths in ids order within segs Check if a value has been assigned to Lens data member. More... | |
bool | CanGetLens (void) const |
Check if it is safe to call GetLens method. More... | |
void | ResetLens (void) |
Reset Lens data member. More... | |
const TLens & | GetLens (void) const |
Get the Lens member data. More... | |
TLens & | SetLens (void) |
Assign a value to Lens data member. More... | |
bool | IsSetStrands (void) const |
Check if a value has been assigned to Strands data member. More... | |
bool | CanGetStrands (void) const |
Check if it is safe to call GetStrands method. More... | |
void | ResetStrands (void) |
Reset Strands data member. More... | |
const TStrands & | GetStrands (void) const |
Get the Strands member data. More... | |
TStrands & | SetStrands (void) |
Assign a value to Strands data member. More... | |
bool | IsSetScores (void) const |
score for each seg Check if a value has been assigned to Scores data member. More... | |
bool | CanGetScores (void) const |
Check if it is safe to call GetScores method. More... | |
void | ResetScores (void) |
Reset Scores data member. More... | |
const TScores & | GetScores (void) const |
Get the Scores member data. More... | |
TScores & | SetScores (void) |
Assign a value to Scores data member. More... | |
virtual void | Reset (void) |
Reset the whole object. More... | |
Public Member Functions inherited from CSerialObject | |
CSerialObject (void) | |
virtual | ~CSerialObject (void) |
virtual const CTypeInfo * | GetThisTypeInfo (void) const =0 |
virtual void | Assign (const CSerialObject &source, ESerialRecursionMode how=eRecursive) |
Set object to copy of another one. More... | |
virtual bool | Equals (const CSerialObject &object, ESerialRecursionMode how=eRecursive) const |
Check if both objects contain the same values. More... | |
virtual void | DebugDump (CDebugDumpContext ddc, unsigned int depth) const |
Define method for dumping debug information. More... | |
void | ThrowUnassigned (TMemberIndex index) const |
void | ThrowUnassigned (TMemberIndex index, const char *file_name, int file_line) const |
bool | HasNamespaceName (void) const |
Check if object data type has namespace name. More... | |
const string & | GetNamespaceName (void) const |
Get namespace name. More... | |
bool | HasNamespacePrefix (void) const |
Check if data type has namespace prefix. More... | |
const string & | GetNamespacePrefix (void) const |
Get namespace prefix. More... | |
Public Member Functions inherited from CObject | |
CObject (void) | |
Constructor. More... | |
CObject (const CObject &src) | |
Copy constructor. More... | |
virtual | ~CObject (void) |
Destructor. More... | |
CObject & | operator= (const CObject &src) THROWS_NONE |
Assignment operator. More... | |
bool | CanBeDeleted (void) const THROWS_NONE |
Check if object can be deleted. More... | |
bool | IsAllocatedInPool (void) const THROWS_NONE |
Check if object is allocated in memory pool (not system heap) More... | |
bool | Referenced (void) const THROWS_NONE |
Check if object is referenced. More... | |
bool | ReferencedOnlyOnce (void) const THROWS_NONE |
Check if object is referenced only once. More... | |
void | AddReference (void) const |
Add reference to object. More... | |
void | RemoveReference (void) const |
Remove reference to object. More... | |
void | ReleaseReference (void) const |
Remove reference without deleting object. More... | |
virtual void | DoNotDeleteThisObject (void) |
Mark this object as not allocated in heap – do not delete this object. More... | |
virtual void | DoDeleteThisObject (void) |
Mark this object as allocated in heap – object can be deleted. More... | |
void * | operator new (size_t size) |
Define new operator for memory allocation. More... | |
void * | operator new[] (size_t size) |
Define new[] operator for 'array' memory allocation. More... | |
void | operator delete (void *ptr) |
Define delete operator for memory deallocation. More... | |
void | operator delete[] (void *ptr) |
Define delete[] operator for memory deallocation. More... | |
void * | operator new (size_t size, void *place) |
Define new operator. More... | |
void | operator delete (void *ptr, void *place) |
Define delete operator. More... | |
void * | operator new (size_t size, CObjectMemoryPool *place) |
Define new operator using memory pool. More... | |
void | operator delete (void *ptr, CObjectMemoryPool *place) |
Define delete operator. More... | |
Public Member Functions inherited from CDebugDumpable | |
CDebugDumpable (void) | |
virtual | ~CDebugDumpable (void) |
void | DebugDumpText (ostream &out, const string &bundle, unsigned int depth) const |
void | DebugDumpFormat (CDebugDumpFormatter &ddf, const string &bundle, unsigned int depth) const |
void | DumpToConsole (void) const |
Private Types | |
typedef CSerialObject | Tparent |
Private Member Functions | |
CDense_seg_Base (const CDense_seg_Base &) | |
CDense_seg_Base & | operator= (const CDense_seg_Base &) |
Private Attributes | |
Uint4 | m_set_State [1] |
int | m_Dim |
int | m_Numseg |
vector< CRef< CSeq_id > > | m_Ids |
vector< TSignedSeqPos > | m_Starts |
vector< TSeqPos > | m_Lens |
vector< ENa_strand > | m_Strands |
vector< CRef< CScore > > | m_Scores |
Additional Inherited Members | |
Static Public Member Functions inherited from CSerialObject | |
static void | SetVerifyDataThread (ESerialVerifyData verify) |
static void | SetVerifyDataGlobal (ESerialVerifyData verify) |
static string | UnassignedString (void) |
static CStringUTF8 | UnassignedStringUTF8 (void) |
static char | UnassignedByte (void) |
Static Public Member Functions inherited from CObject | |
static NCBI_XNCBI_EXPORT void | ThrowNullPointerException (void) |
Define method to throw null pointer exception. More... | |
static NCBI_XNCBI_EXPORT void | ThrowNullPointerException (const type_info &type) |
static EAllocFillMode | GetAllocFillMode (void) |
static void | SetAllocFillMode (EAllocFillMode mode) |
static void | SetAllocFillMode (const string &value) |
Set mode from configuration parameter value. More... | |
Static Public Member Functions inherited from CDebugDumpable | |
static void | EnableDebugDump (bool on) |
Static Public Attributes inherited from CSerialObject | |
static const char * | ms_UnassignedStr = "<*unassigned*>" |
static const char | ms_UnassignedByte = char(0xcd) |
Static Public Attributes inherited from CObject | |
static const TCount | eCounterBitsCanBeDeleted = 1 << 0 |
Define possible object states. More... | |
static const TCount | eCounterBitsInPlainHeap = 1 << 1 |
Heap signature was found. More... | |
static const TCount | eCounterBitsPlaceMask |
Mask for 'in heap' state flags. More... | |
static const int | eCounterStep = 1 << 2 |
Skip over the "in heap" bits. More... | |
static const TCount | eCounterValid = TCount(1) << (sizeof(TCount) * 8 - 2) |
Minimal value for valid objects (reference counter is zero) Must be a single bit value. More... | |
static const TCount | eCounterStateMask |
Valid object, and object in heap. More... | |
Protected Member Functions inherited from CObject | |
virtual void | DeleteThis (void) |
Virtual method "deleting" this object. More... | |
Dense-seg: the densist packing for sequence alignments only.
a start of -1 indicates a gap for that sequence of length lens.
id=100 AAGGCCTTTTAGAGATGATGATGATGATGA id=200 AAGGCCTTTTAG.......GATGATGATGA id=300 ....CCTTTTAGAGATGATGAT....ATGA
dim = 3, numseg = 6, ids = { 100, 200, 300 } starts = { 0,0,-1, 4,4,0, 12,-1,8, 19,12,15, 22,15,-1, 26,19,18 } lens = { 4, 8, 7, 3, 4, 4 }
for (multiway) global or partial alignments
Definition at line 91 of file Dense_seg_.hpp.