NCBI C++ ToolKit
Public Types | Public Member Functions | Private Types | Private Member Functions | Private Attributes | List of all members

Represents ASN.1 type Dense-seg defined in file seqalign.asn

Search Toolkit Book for CDense_seg_Base

Dense-seg: the densist packing for sequence alignments only. More...

#include <objects/seqalign/Dense_seg_.hpp>

+ Inheritance diagram for CDense_seg_Base:
+ Collaboration diagram for CDense_seg_Base:

Public Types

enum class  E_memberIndex {
  e__allMandatory = 0 , e_dim , e_numseg , e_ids ,
  e_starts , e_lens , e_strands , e_scores
}
 
typedef int TDim
 
typedef int TNumseg
 
typedef vector< CRef< CSeq_id > > TIds
 
typedef vector< TSignedSeqPosTStarts
 
typedef vector< TSeqPosTLens
 
typedef vector< ENa_strandTStrands
 
typedef vector< CRef< CScore > > TScores
 
typedef Tparent::CMemberIndex< E_memberIndex, 8 > TmemberIndex
 
- Public Types inherited from CObject
enum  EAllocFillMode { eAllocFillNone = 1 , eAllocFillZero , eAllocFillPattern }
 Control filling of newly allocated memory. More...
 
typedef CObjectCounterLocker TLockerType
 Default locker type for CRef. More...
 
typedef atomic< Uint8TCounter
 Counter type is CAtomiCounter. More...
 
typedef Uint8 TCount
 Alias for value type of counter. More...
 

Public Member Functions

 CDense_seg_Base (void)
 
virtual ~CDense_seg_Base (void)
 
 DECLARE_INTERNAL_TYPE_INFO ()
 
bool IsSetDim (void) const
 dimensionality Check if a value has been assigned to Dim data member. More...
 
bool CanGetDim (void) const
 Check if it is safe to call GetDim method. More...
 
void ResetDim (void)
 Reset Dim data member. More...
 
void SetDefaultDim (void)
 Assign default value to Dim data member. More...
 
TDim GetDim (void) const
 Get the Dim member data. More...
 
void SetDim (TDim value)
 Assign a value to Dim data member. More...
 
TDimSetDim (void)
 Assign a value to Dim data member. More...
 
bool IsSetNumseg (void) const
 number of segments here Check if a value has been assigned to Numseg data member. More...
 
bool CanGetNumseg (void) const
 Check if it is safe to call GetNumseg method. More...
 
void ResetNumseg (void)
 Reset Numseg data member. More...
 
TNumseg GetNumseg (void) const
 Get the Numseg member data. More...
 
void SetNumseg (TNumseg value)
 Assign a value to Numseg data member. More...
 
TNumsegSetNumseg (void)
 Assign a value to Numseg data member. More...
 
bool IsSetIds (void) const
 sequences in order Check if a value has been assigned to Ids data member. More...
 
bool CanGetIds (void) const
 Check if it is safe to call GetIds method. More...
 
void ResetIds (void)
 Reset Ids data member. More...
 
const TIdsGetIds (void) const
 Get the Ids member data. More...
 
TIdsSetIds (void)
 Assign a value to Ids data member. More...
 
bool IsSetStarts (void) const
 start OFFSETS in ids order within segs Check if a value has been assigned to Starts data member. More...
 
bool CanGetStarts (void) const
 Check if it is safe to call GetStarts method. More...
 
void ResetStarts (void)
 Reset Starts data member. More...
 
const TStartsGetStarts (void) const
 Get the Starts member data. More...
 
TStartsSetStarts (void)
 Assign a value to Starts data member. More...
 
bool IsSetLens (void) const
 lengths in ids order within segs Check if a value has been assigned to Lens data member. More...
 
bool CanGetLens (void) const
 Check if it is safe to call GetLens method. More...
 
void ResetLens (void)
 Reset Lens data member. More...
 
const TLensGetLens (void) const
 Get the Lens member data. More...
 
TLensSetLens (void)
 Assign a value to Lens data member. More...
 
bool IsSetStrands (void) const
 Check if a value has been assigned to Strands data member. More...
 
bool CanGetStrands (void) const
 Check if it is safe to call GetStrands method. More...
 
void ResetStrands (void)
 Reset Strands data member. More...
 
const TStrandsGetStrands (void) const
 Get the Strands member data. More...
 
TStrandsSetStrands (void)
 Assign a value to Strands data member. More...
 
bool IsSetScores (void) const
 score for each seg Check if a value has been assigned to Scores data member. More...
 
bool CanGetScores (void) const
 Check if it is safe to call GetScores method. More...
 
void ResetScores (void)
 Reset Scores data member. More...
 
const TScoresGetScores (void) const
 Get the Scores member data. More...
 
TScoresSetScores (void)
 Assign a value to Scores data member. More...
 
virtual void Reset (void)
 Reset the whole object. More...
 
- Public Member Functions inherited from CSerialObject
 CSerialObject (void)
 
virtual ~CSerialObject (void)
 
virtual const CTypeInfoGetThisTypeInfo (void) const =0
 
virtual void Assign (const CSerialObject &source, ESerialRecursionMode how=eRecursive)
 Set object to copy of another one. More...
 
virtual bool Equals (const CSerialObject &object, ESerialRecursionMode how=eRecursive) const
 Check if both objects contain the same values. More...
 
virtual void DebugDump (CDebugDumpContext ddc, unsigned int depth) const
 Define method for dumping debug information. More...
 
void ThrowUnassigned (TMemberIndex index) const
 
void ThrowUnassigned (TMemberIndex index, const char *file_name, int file_line) const
 
bool HasNamespaceName (void) const
 Check if object data type has namespace name. More...
 
const stringGetNamespaceName (void) const
 Get namespace name. More...
 
bool HasNamespacePrefix (void) const
 Check if data type has namespace prefix. More...
 
const stringGetNamespacePrefix (void) const
 Get namespace prefix. More...
 
- Public Member Functions inherited from CObject
 CObject (void)
 Constructor. More...
 
 CObject (const CObject &src)
 Copy constructor. More...
 
virtual ~CObject (void)
 Destructor. More...
 
CObjectoperator= (const CObject &src) THROWS_NONE
 Assignment operator. More...
 
bool CanBeDeleted (void) const THROWS_NONE
 Check if object can be deleted. More...
 
bool IsAllocatedInPool (void) const THROWS_NONE
 Check if object is allocated in memory pool (not system heap) More...
 
bool Referenced (void) const THROWS_NONE
 Check if object is referenced. More...
 
bool ReferencedOnlyOnce (void) const THROWS_NONE
 Check if object is referenced only once. More...
 
void AddReference (void) const
 Add reference to object. More...
 
void RemoveReference (void) const
 Remove reference to object. More...
 
void ReleaseReference (void) const
 Remove reference without deleting object. More...
 
virtual void DoNotDeleteThisObject (void)
 Mark this object as not allocated in heap – do not delete this object. More...
 
virtual void DoDeleteThisObject (void)
 Mark this object as allocated in heap – object can be deleted. More...
 
void * operator new (size_t size)
 Define new operator for memory allocation. More...
 
void * operator new[] (size_t size)
 Define new[] operator for 'array' memory allocation. More...
 
void operator delete (void *ptr)
 Define delete operator for memory deallocation. More...
 
void operator delete[] (void *ptr)
 Define delete[] operator for memory deallocation. More...
 
void * operator new (size_t size, void *place)
 Define new operator. More...
 
void operator delete (void *ptr, void *place)
 Define delete operator. More...
 
void * operator new (size_t size, CObjectMemoryPool *place)
 Define new operator using memory pool. More...
 
void operator delete (void *ptr, CObjectMemoryPool *place)
 Define delete operator. More...
 
- Public Member Functions inherited from CDebugDumpable
 CDebugDumpable (void)
 
virtual ~CDebugDumpable (void)
 
void DebugDumpText (ostream &out, const string &bundle, unsigned int depth) const
 
void DebugDumpFormat (CDebugDumpFormatter &ddf, const string &bundle, unsigned int depth) const
 
void DumpToConsole (void) const
 

Private Types

typedef CSerialObject Tparent
 

Private Member Functions

 CDense_seg_Base (const CDense_seg_Base &)
 
CDense_seg_Baseoperator= (const CDense_seg_Base &)
 

Private Attributes

Uint4 m_set_State [1]
 
int m_Dim
 
int m_Numseg
 
vector< CRef< CSeq_id > > m_Ids
 
vector< TSignedSeqPosm_Starts
 
vector< TSeqPosm_Lens
 
vector< ENa_strandm_Strands
 
vector< CRef< CScore > > m_Scores
 

Additional Inherited Members

- Static Public Member Functions inherited from CSerialObject
static void SetVerifyDataThread (ESerialVerifyData verify)
 
static void SetVerifyDataGlobal (ESerialVerifyData verify)
 
static string UnassignedString (void)
 
static CStringUTF8 UnassignedStringUTF8 (void)
 
static char UnassignedByte (void)
 
- Static Public Member Functions inherited from CObject
static NCBI_XNCBI_EXPORT void ThrowNullPointerException (void)
 Define method to throw null pointer exception. More...
 
static NCBI_XNCBI_EXPORT void ThrowNullPointerException (const type_info &type)
 
static EAllocFillMode GetAllocFillMode (void)
 
static void SetAllocFillMode (EAllocFillMode mode)
 
static void SetAllocFillMode (const string &value)
 Set mode from configuration parameter value. More...
 
- Static Public Member Functions inherited from CDebugDumpable
static void EnableDebugDump (bool on)
 
- Static Public Attributes inherited from CSerialObject
static const char * ms_UnassignedStr = "<*unassigned*>"
 
static const char ms_UnassignedByte = char(0xcd)
 
- Static Public Attributes inherited from CObject
static const TCount eCounterBitsCanBeDeleted = 1 << 0
 Define possible object states. More...
 
static const TCount eCounterBitsInPlainHeap = 1 << 1
 Heap signature was found. More...
 
static const TCount eCounterBitsPlaceMask
 Mask for 'in heap' state flags. More...
 
static const int eCounterStep = 1 << 2
 Skip over the "in heap" bits. More...
 
static const TCount eCounterValid = TCount(1) << (sizeof(TCount) * 8 - 2)
 Minimal value for valid objects (reference counter is zero) Must be a single bit value. More...
 
static const TCount eCounterStateMask
 Valid object, and object in heap. More...
 
- Protected Member Functions inherited from CObject
virtual void DeleteThis (void)
 Virtual method "deleting" this object. More...
 

Detailed Description

Dense-seg: the densist packing for sequence alignments only.

a start of -1 indicates a gap for that sequence of length lens.

id=100 AAGGCCTTTTAGAGATGATGATGATGATGA id=200 AAGGCCTTTTAG.......GATGATGATGA id=300 ....CCTTTTAGAGATGATGAT....ATGA

dim = 3, numseg = 6, ids = { 100, 200, 300 } starts = { 0,0,-1, 4,4,0, 12,-1,8, 19,12,15, 22,15,-1, 26,19,18 } lens = { 4, 8, 7, 3, 4, 4 }

for (multiway) global or partial alignments

CDense_seg_Base

Definition at line 91 of file Dense_seg_.hpp.


The documentation for this class was generated from the following files:
Modified on Fri Dec 08 08:21:14 2023 by modify_doxy.py rev. 669887