toti_minion_WGS_20230802_invitrogen_I3

Warning: The NCBI web site requires JavaScript to function. more...

Result Filters

Identifiers: BioSample: SAMEA115615483; Sample name: toti_minion_WGS_20230802_invitrogen_I3; SRA: ERS19893063

Organism: Canis lupus familiaris (dog)
cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Deuterostomia; Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi; Euteleostomi; Sarcopterygii; Dipnotetrapodomorpha; Tetrapoda; Amniota; Mammalia; Theria; Eutheria; Boreoeutheria; Laurasiatheria; Carnivora; Caniformia; Canidae; Canis; Canis lupus

Attributes

broad-scale environmental context	Csongrad county
host	Canis lupus familiaris
collection date	2021-12-01
host family relationship	Harsanyi-Tekergo Bator
host subject id	not applicable
host subspecific genetic lineage	cross-breeding of Hungarian Puli with French and German herding dogs originated from 17. century
host common name	Hungarian herding terrier: Pumi
host sex	male
temperature	20
geographic location	Hungary
sample storage temperature	-80
host taxonomy ID	9615 (9615)
environmental medium	no
host diet	omnivore
sample storage duration	n.a
host body product	stool
organism count	not collected
project name	Ultra-deep, hybrid metagenomic sequencing of canine gut microbiome
host age	13 years
chimera check software	minitax
sequence quality check	LongQC
target gene	whole genome
geographic location (longitude)	20.14824
nucleic acid extraction	PureLink Microbiome DNA Purification Kit, Invitrogen
nucleic acid amplification	LongAmp Taq 2X Master Mix
library reads sequenced	not provided
adapters	Top strand: 5'-TTTTTTTTCCTGTACTTCGTTCAGTTACGTATTGCT-3' / Bottom strand: 5'-ACGTAACTGAACGAAGTACAGG-3'
organism	Canis lupus familiaris
library construction method	Native Barcoding Kit 24 V14 (SQK-NBD114.24)
library size	not provided
geographic location (latitude)	46.253
scientific_name	Canis lupus familiaris
common name	dog
target subfragment	not applicable
pcr primers	not applicable
pcr conditions	no pcr
local environmental context	Szeged
sequencing method	Oxford Nanopore, SQK-NBD114.24
library screening strategy	ligation based
multiplex identifiers	CCTGGTAACTGGGACACAAGACTC