Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Library is oligo-dT primed and directionally cloned Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 4-5Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter primer 5'd (TAATACGACTCACTATAGGG)3'. Library was constructed in the laboratory of M. Bento Soares. Note: this is a NIH_MGC Library
Nucleotide
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on