BioSample

Gametocysts of Gregarina niphandrodes were obtained from Tenebrio molitor. The cDNA library was constructed at Washington Univ. cDNA was synthesized from poly(A)+ mRNA using the template-switching PCR method (SMART cDNA Kit, BD Biosciences). First strand cDNA was reverse transcribed using the CDS III/3' primer and a 5' template switch primer (Smart IV primer). The product of the first strand synthesis was PCR amplified using the same primer set and the fragments were digested with SfiI. The fragments were size selected, ligated into a modified pBluescript vector (obtained from Michael White, Montana State University) containing directional SfiI sites, and electroporated into ElectroTen Blue cells. Vector: SfiI sites were added to the multiple cloning region of pBluescript SK+ between the BamHI/EcoRI sites. The modified polylinker has the following sequence: 5'GAATTCGGCCATTACGGCC (G)n-- insert-- GGCCGCCTCGGCCCACGGATCC3'where n=3-4 G nucleotides.