BioSample

RNA obtained from human embryonic stem cells isolated from the inner cell mass of blastocyst stage embryos and differentiated to an early endodermal cell type. Cell line id and NIH Registry designation is BGO1. Positive for GATA4, MixL1, Msx1, HNF4alpha expression; negative for AFP expression. Passage number 40. cDNA primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. This primary library is non-normalized (normalized primary library is NIH_MGC_259). It was constructed by Express Genomics (Frederick, MD). Sequence ends have been trimmed to exclude vector and regions below Phred quality 16. Three-prime sequences are presented as their reverse complement and have been trimmed to exclude polyA. Note: this is a Mammalian Gene Collection library.