BioSample

RNA obtained from human embryonic stem cells isolated from the inner cell mass of blastocyst stage embryos. Cell line id and NIH Registry designation is BGO1. Positive for SSEA3, SSEA4, Tra 1-60, Tra 1-81, CD9, Alk Phos, Oct4 and Nanog expression; negative for SSEA1 expression. Passage number 21. cDNA primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. This primary library is non-normalized (normalized primary library is NIH_MGC_261). It was constructed by Express Genomics (Frederick, MD). Sequence ends have been trimmed to exclude vector and regions below Phred quality 16. Note: this is a Mammalian Gene Collection library.