Variant summary: The variant results in the deletion of a 23 nucleotides leading to a termination codon at position 288 of CTNS. The variant was present at a low frequency in the large and broad cohorts of the ExAC project (3/121,076 chromosomes) while it was observed in multiple CTNS patients in the literature. Considering all evidence, the variant was classified as pathogenic.
ClinVar Genomic variation as it relates to human health
NM_004937.3(CTNS):c.771_793del (p.Gly258fs)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(10)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic
10
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_004937.3(CTNS):c.771_793del (p.Gly258fs)
Variation ID: 496276 Accession: VCV000496276.19
- Type and length
-
Deletion, 23 bp
- Location
-
Cytogenetic: 17p13.2 17: 3658082-3658104 (GRCh38) [ NCBI UCSC ] 17: 3561376-3561398 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Mar 17, 2018 Oct 8, 2024 Mar 25, 2024 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_004937.3:c.771_793del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_004928.2:p.Gly258fs frameshift NM_001031681.3:c.771_793del NP_001026851.2:p.Gly258fs frameshift NM_001374492.1:c.771_793del NP_001361421.1:p.Gly258fs frameshift NM_001374493.1:c.330_352del NP_001361422.1:p.Gly111fs frameshift NM_001374494.1:c.330_352del NP_001361423.1:p.Gly111fs frameshift NM_001374495.1:c.330_352del NP_001361424.1:p.Gly111fs frameshift NM_001374496.1:c.330_352del NP_001361425.1:p.Gly111fs frameshift NC_000017.11:g.3658094_3658116del NC_000017.10:g.3561388_3561410del NG_012489.2:g.26627_26649del - Protein change
- G258fs, G111fs
- Other names
- -
- Canonical SPDI
- NC_000017.11:3658081:CGTGGCTGCAGTGGGAGTGACCACGTGGCTGCAGT:CGTGGCTGCAGT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| CTNS | - | - |
GRCh38 GRCh37 |
515 | 927 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (3) |
criteria provided, multiple submitters, no conflicts
|
Jul 5, 2017 | RCV000586519.12 | |
| Pathogenic (5) |
criteria provided, multiple submitters, no conflicts
|
Mar 25, 2024 | RCV000984254.14 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Dec 2, 2021 | RCV003139887.10 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Aug 5, 2023 | RCV002530936.10 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Jul 05, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Cystinosis
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000698526.1
First in ClinVar: Mar 17, 2018 Last updated: Mar 17, 2018 |
Comment:
Variant summary: The variant results in the deletion of a 23 nucleotides leading to a termination codon at position 288 of CTNS. The variant was … (more)
Variant summary: The variant results in the deletion of a 23 nucleotides leading to a termination codon at position 288 of CTNS. The variant was present at a low frequency in the large and broad cohorts of the ExAC project (3/121,076 chromosomes) while it was observed in multiple CTNS patients in the literature. Considering all evidence, the variant was classified as pathogenic. (less)
|
|
|
Pathogenic
(-)
|
criteria provided, single submitter
Method: clinical testing
|
Cystinosis
Affected status: yes
Allele origin:
germline
|
Centogene AG - the Rare Disease Company
Accession: SCV001424396.1
First in ClinVar: Jul 25, 2020 Last updated: Jul 25, 2020 |
|
|
|
Pathogenic
(Apr 26, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Nephropathic cystinosis
Affected status: unknown
Allele origin:
germline
|
Johns Hopkins Genomics, Johns Hopkins University
Accession: SCV001573147.1
First in ClinVar: May 07, 2021 Last updated: May 07, 2021 |
Comment:
This 23 bp deletion in CTNS has been previously reported in individuals with nephropathic cystinosis. This CTNS variant (rs759623796) is rare (<0.1%) in a large … (more)
This 23 bp deletion in CTNS has been previously reported in individuals with nephropathic cystinosis. This CTNS variant (rs759623796) is rare (<0.1%) in a large population dataset (gnomAD: 7/251296 total alleles; 0.003%; no homozygotes) and there is an entry in ClinVar. This frameshift variant results in a premature stop codon in exon 11 likely leading to nonsense-mediated decay and lack of protein production. We consider this variant to be pathogenic. (less)
|
|
|
Pathogenic
(Aug 05, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Inborn genetic diseases
Ocular cystinosis Juvenile nephropathic cystinosis
Explanation for multiple conditions: Uncertain.
The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases.
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV000961592.4
First in ClinVar: Aug 14, 2019 Last updated: Feb 28, 2024 |
Comment:
For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this … (more)
For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 496276). This variant is also known as c.1109_1131del23. This premature translational stop signal has been observed in individuals with cystinosis (PMID: 10556299, 26266097). This variant is present in population databases (rs759623796, gnomAD 0.02%). This sequence change creates a premature translational stop signal (p.Gly258Serfs*30) in the CTNS gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CTNS are known to be pathogenic (PMID: 9537412, 27102039). (less)
|
|
|
Pathogenic
(Dec 25, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Nephropathic cystinosis
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV004215218.1
First in ClinVar: Dec 30, 2023 Last updated: Dec 30, 2023 |
|
|
|
Pathogenic
(Dec 02, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Revvity Omics, Revvity
Accession: SCV003819373.2
First in ClinVar: Mar 04, 2023 Last updated: Feb 04, 2024 |
|
|
|
Pathogenic
(Mar 25, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Nephropathic cystinosis
Affected status: unknown
Allele origin:
germline
|
Center for Genomic Medicine, King Faisal Specialist Hospital and Research Center
Accession: SCV004806437.1
First in ClinVar: Apr 06, 2024 Last updated: Apr 06, 2024 |
|
|
|
Pathogenic
(May 20, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Nephropathic cystinosis
(Autosomal recessive inheritance)
Affected status: yes
Allele origin:
germline
|
Neuberg Centre For Genomic Medicine, NCGM
Accession: SCV005329277.1
First in ClinVar: Oct 08, 2024 Last updated: Oct 08, 2024 |
Comment:
The observed frameshift c.771_793del (p.Gly258SerfsTer30) variant in CTNS gene has been reported in homozygous state in individual(s) affected with cystinosis (Chkioua L et al., 2015; … (more)
The observed frameshift c.771_793del (p.Gly258SerfsTer30) variant in CTNS gene has been reported in homozygous state in individual(s) affected with cystinosis (Chkioua L et al., 2015; Ghazi F, et. al., 2017). The p.Gly258SerfsTer30 variant is present with allele frequency 0.003% in gnomAD Exomes database. This variant has been submitted to the ClinVar database as Likely Pathogenic / Pathogenic (multiple submitters). This variant causes a frameshift starting with codon Glycine 258, changes this amino acid to Serine residue, and creates a premature Stop codon at position 30 of the new reading frame, denoted p.Gly258SerfsTer30. This variant is predicted to cause loss of normal protein function through protein truncation. Loss-of-function variants in CTNS are known to be pathogenic (Elmonem MA, et. al., 2016). For these reasons, this variant has been classified as Pathogenic. (less)
Clinical Features:
Abnormality of the kidney (present)
|
|
|
Likely pathogenic
(Aug 16, 2014)
|
no assertion criteria provided
Method: clinical testing
|
Nephropathic cystinosis
Affected status: unknown
Allele origin:
unknown
|
Counsyl
Accession: SCV001132377.1
First in ClinVar: Dec 23, 2019 Last updated: Dec 23, 2019 |
|
|
|
Pathogenic
(Jan 26, 2021)
|
no assertion criteria provided
Method: clinical testing
|
Cystinosis
Affected status: unknown
Allele origin:
germline
|
Natera, Inc.
Accession: SCV002093236.1
First in ClinVar: Apr 23, 2022 Last updated: Apr 23, 2022 |
|
Comment:
Comment:
This 23 bp deletion in CTNS has been previously reported in individuals with nephropathic cystinosis. This CTNS variant (rs759623796) is rare (<0.1%) in a large population dataset (gnomAD: 7/251296 total alleles; 0.003%; no homozygotes) and there is an entry in ClinVar. This frameshift variant results in a premature stop codon in exon 11 likely leading to nonsense-mediated decay and lack of protein production. We consider this variant to be pathogenic.
Comment:
For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 496276). This variant is also known as c.1109_1131del23. This premature translational stop signal has been observed in individuals with cystinosis (PMID: 10556299, 26266097). This variant is present in population databases (rs759623796, gnomAD 0.02%). This sequence change creates a premature translational stop signal (p.Gly258Serfs*30) in the CTNS gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CTNS are known to be pathogenic (PMID: 9537412, 27102039).
Comment:
The observed frameshift c.771_793del (p.Gly258SerfsTer30) variant in CTNS gene has been reported in homozygous state in individual(s) affected with cystinosis (Chkioua L et al., 2015; Ghazi F, et. al., 2017). The p.Gly258SerfsTer30 variant is present with allele frequency 0.003% in gnomAD Exomes database. This variant has been submitted to the ClinVar database as Likely Pathogenic / Pathogenic (multiple submitters). This variant causes a frameshift starting with codon Glycine 258, changes this amino acid to Serine residue, and creates a premature Stop codon at position 30 of the new reading frame, denoted p.Gly258SerfsTer30. This variant is predicted to cause loss of normal protein function through protein truncation. Loss-of-function variants in CTNS are known to be pathogenic (Elmonem MA, et. al., 2016). For these reasons, this variant has been classified as Pathogenic.
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
Variant summary: The variant results in the deletion of a 23 nucleotides leading to a termination codon at position 288 of CTNS. The variant was present at a low frequency in the large and broad cohorts of the ExAC project (3/121,076 chromosomes) while it was observed in multiple CTNS patients in the literature. Considering all evidence, the variant was classified as pathogenic.
Comment:
This 23 bp deletion in CTNS has been previously reported in individuals with nephropathic cystinosis. This CTNS variant (rs759623796) is rare (<0.1%) in a large population dataset (gnomAD: 7/251296 total alleles; 0.003%; no homozygotes) and there is an entry in ClinVar. This frameshift variant results in a premature stop codon in exon 11 likely leading to nonsense-mediated decay and lack of protein production. We consider this variant to be pathogenic.
Comment:
For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 496276). This variant is also known as c.1109_1131del23. This premature translational stop signal has been observed in individuals with cystinosis (PMID: 10556299, 26266097). This variant is present in population databases (rs759623796, gnomAD 0.02%). This sequence change creates a premature translational stop signal (p.Gly258Serfs*30) in the CTNS gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CTNS are known to be pathogenic (PMID: 9537412, 27102039).
Comment:
The observed frameshift c.771_793del (p.Gly258SerfsTer30) variant in CTNS gene has been reported in homozygous state in individual(s) affected with cystinosis (Chkioua L et al., 2015; Ghazi F, et. al., 2017). The p.Gly258SerfsTer30 variant is present with allele frequency 0.003% in gnomAD Exomes database. This variant has been submitted to the ClinVar database as Likely Pathogenic / Pathogenic (multiple submitters). This variant causes a frameshift starting with codon Glycine 258, changes this amino acid to Serine residue, and creates a premature Stop codon at position 30 of the new reading frame, denoted p.Gly258SerfsTer30. This variant is predicted to cause loss of normal protein function through protein truncation. Loss-of-function variants in CTNS are known to be pathogenic (Elmonem MA, et. al., 2016). For these reasons, this variant has been classified as Pathogenic.
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Cystinosis: a review. | Elmonem MA | Orphanet journal of rare diseases | 2016 | PMID: 27102039 |
| Genetic basis of cystinosis in Tunisian patients: Identification of novel mutation in CTNS gene. | Chkioua L | Meta gene | 2015 | PMID: 26266097 |
| Severity of phenotype in cystinosis varies with mutations in the CTNS gene: predicted effect on the model of cystinosin. | Attard M | Human molecular genetics | 1999 | PMID: 10556299 |
| A novel gene encoding an integral membrane protein is mutated in nephropathic cystinosis. | Town M | Nature genetics | 1998 | PMID: 9537412 |
Text-mined citations for rs759623796 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Oct 27, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.