VCV000004847.72 - ClinVar

NM_007254.4(PNKP):c.1253_1269dup (p.Thr424fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(18)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_007254.4(PNKP):c.1253_1269dup (p.Thr424fs)

Variation ID: 4847 Accession: VCV000004847.72

Type and length

Duplication, 17 bp

Location

Cytogenetic: 19q13.33 19: 49861800-49861801 (GRCh38) [ NCBI UCSC ] 19: 50365057-50365058 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Nov 23, 2014	Oct 20, 2024	Dec 2, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_007254.4:c.1253_1269dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_009185.2:p.Thr424fs	frameshift
NM_007254.4:c.1253_1269dupGGGTCGCCATCGACAAC MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_007254.2:c.1253_1269dupGGGTCGCCATCGACAAC
NM_007254.3:c.1253_1269dupGGGTCGCCATCGACAAC
NC_000019.10:g.49861804_49861820dup
NC_000019.9:g.50365061_50365077dup
NG_027717.1:g.10749_10765dup
NG_050666.1:g.17961_17977dup

... more HGVS ... less HGVS

Protein change

T424fs

Other names

Canonical SPDI

NC_000019.10:49861800:GTTGTCGATGGCGACCCGTT:GTTGTCGATGGCGACCCGTTGTCGATGGCGACCCGTT

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA213109 OMIM: 605610.0002 dbSNP: rs587784365 VarSome

Comment on variant

NCBI staff reviewed the sequence information reported in PubMed 20118933 to determine the location of this allele on the current reference sequence. Note that Fig. 3a has a typographical error in their description of the duplication as '17-bp dup 1250_1266dupGGGTCGCCCATCGACAAC'. The correct duplication sequence is GGGTCGCCATCGACAAC, as shown in their Supplementary Fig. 3c.

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
PNKP		-	-	GRCh38 GRCh37	1134	1149

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Microcephaly, seizures, and developmental delay	Pathogenic (6)	criteria provided, multiple submitters, no conflicts	May 6, 2021	RCV000005120.25
Ataxia - oculomotor apraxia type 4	Pathogenic (1)	no assertion criteria provided	Mar 5, 2015	RCV000167521.9
not provided	Pathogenic (7)	criteria provided, multiple submitters, no conflicts	Jun 1, 2023	RCV000188471.39
Developmental and epileptic encephalopathy, 12	Pathogenic (1)	criteria provided, single submitter	Dec 2, 2023	RCV000706286.10
Abnormality of the nervous system	Pathogenic (1)	criteria provided, single submitter	Jul 10, 2021	RCV001813954.4
Inborn genetic diseases	Pathogenic (1)	criteria provided, single submitter	Jun 11, 2019	RCV002415399.4
Intellectual disability	Pathogenic (1)	criteria provided, single submitter	Apr 20, 2020	RCV001257702.4

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Jun 05, 2014)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Epileptic encephalopathy, early infantile, 10 (Autosomal recessive inheritance) Affected status: yes Allele origin: germline	Genetic Services Laboratory, University of Chicago Accession: SCV000194720.1 First in ClinVar: Nov 23, 2014 Last updated: Nov 23, 2014
Pathogenic (May 13, 2016)	criteria provided, single submitter (EGL Classification Definitions) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Eurofins Ntd Llc (ga) Accession: SCV000341338.3 First in ClinVar: Dec 06, 2016 Last updated: Jul 31, 2019	Other databases http://geneticslab.emory.edu/emv… http://geneticslab.emory.edu/emvclass/emvclass.php?approved_symbol=PNKP Number of individuals with the variant: 1 Sex: mixed
Pathogenic (Jan 16, 2020)	criteria provided, single submitter (Classification criteria August 2017) Method: clinical testing	Microcephaly, seizures, and developmental delay (Autosomal recessive inheritance) Affected status: yes Allele origin: inherited	Institute of Human Genetics Munich, Klinikum Rechts Der Isar, TU München Accession: SCV001149887.1 First in ClinVar: Feb 03, 2020 Last updated: Feb 03, 2020	Observation 1: Sex: female Tissue: blood Observation 2: Sex: female Tissue: blood
Pathogenic (Apr 20, 2020)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Intellectual disability (Autosomal recessive inheritance) Affected status: yes Allele origin: maternal	Diagnostic Laboratory, Strasbourg University Hospital Accession: SCV001434513.1 First in ClinVar: Oct 03, 2020 Last updated: Oct 03, 2020	Clinical Features: Dysmorphic features (present) , severe intellectual disability (present) , hypotonia (present) , cerebellar syndrome (present) , ataxia (present) , movement abnormalities (present) , learning disorder … (more) Dysmorphic features (present) , severe intellectual disability (present) , hypotonia (present) , cerebellar syndrome (present) , ataxia (present) , movement abnormalities (present) , learning disorder (present) , Abnormal MRI (present) , Bulging eyes (present) , delayed sitting (16 months old) (present) , no walking nor talking (present) , thin corpus callosum (present) (less) Family history: yes Age: 0-9 years Sex: female Tissue: blood Method: targeted capture
Pathogenic (Jan 01, 2020)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Microcephaly, seizures, and developmental delay Affected status: yes Allele origin: inherited	Institut de Recherche Interdisciplinaire en Biologie Humaine et Moleculaire, Universite Libre de Bruxelles Accession: SCV001481951.1 First in ClinVar: Jun 15, 2021 Last updated: Jun 15, 2021
Pathogenic (Jul 10, 2021)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Abnormality of the nervous system Affected status: yes Allele origin: germline	Kariminejad - Najmabadi Pathology & Genetics Center Accession: SCV001755558.1 First in ClinVar: Jan 22, 2022 Last updated: Jan 22, 2022
Pathogenic (Dec 20, 2019)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Revvity Omics, Revvity Accession: SCV002019447.3 First in ClinVar: Nov 29, 2021 Last updated: Feb 04, 2024
Pathogenic (May 06, 2021)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Microcephaly, seizures, and developmental delay (Autosomal recessive inheritance) Affected status: unknown Allele origin: germline	Victorian Clinical Genetics Services, Murdoch Childrens Research Institute Additional submitter: Shariant Australia, Australian Genomics Accession: SCV002767068.1 First in ClinVar: Dec 24, 2022 Last updated: Dec 24, 2022	Publications: PubMed (3) PubMed: 22508754‚ 31436889‚ 31707899 Comment: Based on the classification scheme VCGS_Germline_v1.3.3, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism … (more) Based on the classification scheme VCGS_Germline_v1.3.3, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism of disease in this gene and is associated with ataxia-oculomotor apraxia 4 (MIM#616267), and microcephaly, seizures, and developmental delay (MIM#613402). (I) 0106 - This gene is associated with autosomal recessive disease. (I) 0205 - Variant is predicted to result in a truncated protein (premature termination codon is NOT located at least 54 nucleotides upstream of the final exon-exon junction) with less than 1/3 of the protein sequence affected (PMID: 22508754). (SP) 0251 - This variant is heterozygous. (I) 0304 - Variant is present in gnomAD (v2) <0.01 for a recessive condition (38 heterozygotes, 0 homozygotes). (SP) 0600 - Variant results in the loss of part of the annotated AAA domain (PDB). (I) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. The variant has previously been described as pathogenic in multiple homozygous and compound heterozygous patients, with either ataxia-oculomotor apraxia 4 or microcephaly, seizures and developmental delay (ClinVar, PMID: 31436889, PMID: 31707899). (SP) 1102 - Strong phenotype match for this individual. (SP) 1201 - Heterozygous variant detected in trans with a second pathogenic heterozygous variant (p.(Ser430Lysfs*39)) in a recessive disease. (SP) 1206 - This variant has been shown to be paternally inherited (by trio analysis). (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign (less)
Pathogenic (Apr 01, 2022)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV000242085.8 First in ClinVar: Aug 07, 2015 Last updated: Mar 04, 2023	Comment: Published functional studies demonstrate a damaging effect showing that the variant reduces or eliminates PNKP DNA kinase activity (Reynolds et al., 2012); Frameshift variant in … (more) Published functional studies demonstrate a damaging effect showing that the variant reduces or eliminates PNKP DNA kinase activity (Reynolds et al., 2012); Frameshift variant in the C-terminus predicted to result in protein truncation, as the last 98 amino acids are lost and replaced with 48 incorrect amino acids (HGMD); This variant is associated with the following publications: (PMID: 23224214, 25558065, 23921166, 22508754, 25728773, 20118933, 29498415, 28333917, 30956058, 29655203, 30267214, 30214071, 31707899, 31436889, 34402213, 31589614, 31110700, 32504494) (less)
Pathogenic (Dec 02, 2023)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	Developmental and epileptic encephalopathy, 12 Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV000835326.6 First in ClinVar: Oct 10, 2018 Last updated: Feb 14, 2024	Publications: PubMed (6) PubMed: 28492532‚ 20118933‚ 23224214‚ 25558065‚ 25728773‚ 22508754 Comment: This sequence change creates a premature translational stop signal (p.Thr424Glyfs49) in the PNKP gene. While this is not anticipated to result in nonsense mediated decay, … (more) This sequence change creates a premature translational stop signal (p.Thr424Glyfs49) in the PNKP gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 98 amino acid(s) of the PNKP protein. This variant is present in population databases (rs587784365, gnomAD 0.03%). This premature translational stop signal has been observed in individuals with microcephaly, early-onset, intractable seizures and developmental delay (MCSZ), ataxia with oculomotor apraxia, and progressive cerebellar atrophy and polyneuropathy (PMID: 20118933, 23224214, 25558065, 25728773). It has also been observed to segregate with disease in related individuals. This variant is also known as c.1250_1251insAACGGGTCGCCATCGAC (p.R418Tfs*55). ClinVar contains an entry for this variant (Variation ID: 4847). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this premature translational stop signal affects PNKP function (PMID: 22508754). For these reasons, this variant has been classified as Pathogenic. (less)
Pathogenic (Jun 11, 2019)	criteria provided, single submitter (Ambry Variant Classification Scheme 2023) Method: clinical testing	Inborn genetic diseases Affected status: unknown Allele origin: germline	Ambry Genetics Accession: SCV002676502.2 First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024	Comment: The c.1253_1269dup17 pathogenic mutation, located in coding exon 13 of the PNKP gene, results from a duplication of GGGTCGCCATCGACAAC at nucleotide position 1253, causing a … (more) The c.1253_1269dup17 pathogenic mutation, located in coding exon 13 of the PNKP gene, results from a duplication of GGGTCGCCATCGACAAC at nucleotide position 1253, causing a translational frameshift with a predicted alternate stop codon (p.T424Gfs*49). This frameshift occurs at the 3' terminus of PNKP, is not expected to trigger nonsense-mediated mRNA decay, and impacts only the last 98 amino acids of the protein. The exact functional impact of these altered amino acids is unknown at this time. However, this variant has been reported in compound heterozygote and homozygous individuals with microcephaly, seizures and developmental delay, as well as ataxia with oculomotor apraxia type 4 (Shen J et al. Nat. Genet., 2010 Mar;42:245-9; Poulton C et al. Neurogenetics, 2013 Feb;14:43-51; Bras J et al. Am. J. Hum. Genet., 2015 Mar;96:474-9; Scholz C et al. Clin. Genet., 2018 Jul;94:185-186). This variant has also been shown to lose DNA kinase activity in functional studies (Reynolds JJ et al. Nucleic Acids Res., 2012 Aug;40:6608-19). Based on our internal structural assessment, this alteration results in loss of large parts of the polynucleotide kinase domain, including helices involved in DNA and NTP binding (Garces F et al. Mol. Cell, 2011 Nov;44:385-96). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. (less)
Pathogenic (Jun 01, 2023)	criteria provided, single submitter (CeGaT Center For Human Genetics Tuebingen Variant Classification Criteria Version 2) Method: clinical testing	not provided Affected status: yes Allele origin: germline	CeGaT Center for Human Genetics Tuebingen Accession: SCV001747940.20 First in ClinVar: Jul 07, 2021 Last updated: Oct 20, 2024	Comment: PNKP: PM3:Very Strong, PVS1, PM2, PS3:Supporting Number of individuals with the variant: 7
Pathogenic (-)	no assertion criteria provided Method: clinical testing	Microcephaly, seizures, and developmental delay Affected status: yes Allele origin: unknown	Service de Génétique Moléculaire, Hôpital Robert Debré Accession: SCV001432380.1 First in ClinVar: Sep 16, 2020 Last updated: Sep 16, 2020
Pathogenic (Mar 05, 2015)	no assertion criteria provided Method: literature only	ATAXIA-OCULOMOTOR APRAXIA 4 Affected status: not provided Allele origin: germline	OMIM Accession: SCV000218379.4 First in ClinVar: Mar 24, 2015 Last updated: Oct 23, 2020	Publications: PubMed (3) PubMed: 20118933‚ 23224214‚ 25728773 Comment on evidence: In affected members of 2 unrelated families with microcephaly, seizures, and developmental delay (MCSZ; 613402), Shen et al. (2010) identified a homozygous 17-bp duplication (c.1250_1266dup) … (more) In affected members of 2 unrelated families with microcephaly, seizures, and developmental delay (MCSZ; 613402), Shen et al. (2010) identified a homozygous 17-bp duplication (c.1250_1266dup) in exon 14 of the PNKP gene, resulting in a frameshift and premature termination. The families were of Saudi Arabian and Turkish descent, respectively. Lymphocytes derived from affected individuals showed decreased PNKP expression. Two additional unrelated European American families with the disorder were found to be compound heterozygous for the 17-bp duplication and another pathogenic mutations in the PNKP gene: L176F (605610.0003) and a 17-bp deletion (605610.0004). Despite their diverse ancestries, haplotype analysis suggested a common founder for the 17-bp duplication, which was not found in 1,080 Middle Eastern or European control chromosomes. The phenotype was characterized by onset of refractory seizures in infancy, consistent with a developmental and epileptic encephalopathy (DEE). Poulton et al. (2013) identified the same homozygous 17-bp duplication in the PNKP gene in 2 Dutch brothers, born of consanguineous parents, with early childhood onset of a neurodegenerative disorder. The patients had global developmental delay from infancy as well as progressive and severe microcephaly, but seizures were not as severe as those reported by Shen et al. (2010). These patients developed seizures at 12 months and 2.5 years of age. Both Dutch boys also developed progressive cerebellar atrophy and a sensorimotor peripheral neuropathy, resulting in loss of independent ambulation in childhood or adolescence. Poulton et al. (2013) emphasized the neurodegenerative phenotype of these patients and suggested that it was distinct from that reported by Shen et al. (2010). Patient fibroblasts showed increased susceptibility under stress conditions compared to controls. In 2 Portuguese sibs with ataxia-oculomotor apraxia-4 (AOA4; 616267), Bras et al. (2015) identified compound heterozygous mutations in the PNKP gene: the same 17-bp duplication in the PNKP gene identified by Shen et al. (2010) and Poulton et al. (2013), and G375W (605610.0005). Bras et al. (2015) referred to the 17-bp duplication as c.1253_1269dup, resulting in a frameshift and premature termination (Thr424GlyfsTer49) in the kinase domain. Functional studies of the variants were not performed. (less)
Pathogenic (Mar 05, 2015)	no assertion criteria provided Method: literature only	MICROCEPHALY, SEIZURES, AND DEVELOPMENTAL DELAY Affected status: not provided Allele origin: germline	OMIM Accession: SCV000025297.5 First in ClinVar: Apr 04, 2013 Last updated: Oct 23, 2020	Publications: PubMed (3) PubMed: 20118933‚ 23224214‚ 25728773 Comment on evidence: In affected members of 2 unrelated families with microcephaly, seizures, and developmental delay (MCSZ; 613402), Shen et al. (2010) identified a homozygous 17-bp duplication (c.1250_1266dup) … (more) In affected members of 2 unrelated families with microcephaly, seizures, and developmental delay (MCSZ; 613402), Shen et al. (2010) identified a homozygous 17-bp duplication (c.1250_1266dup) in exon 14 of the PNKP gene, resulting in a frameshift and premature termination. The families were of Saudi Arabian and Turkish descent, respectively. Lymphocytes derived from affected individuals showed decreased PNKP expression. Two additional unrelated European American families with the disorder were found to be compound heterozygous for the 17-bp duplication and another pathogenic mutations in the PNKP gene: L176F (605610.0003) and a 17-bp deletion (605610.0004). Despite their diverse ancestries, haplotype analysis suggested a common founder for the 17-bp duplication, which was not found in 1,080 Middle Eastern or European control chromosomes. The phenotype was characterized by onset of refractory seizures in infancy, consistent with a developmental and epileptic encephalopathy (DEE). Poulton et al. (2013) identified the same homozygous 17-bp duplication in the PNKP gene in 2 Dutch brothers, born of consanguineous parents, with early childhood onset of a neurodegenerative disorder. The patients had global developmental delay from infancy as well as progressive and severe microcephaly, but seizures were not as severe as those reported by Shen et al. (2010). These patients developed seizures at 12 months and 2.5 years of age. Both Dutch boys also developed progressive cerebellar atrophy and a sensorimotor peripheral neuropathy, resulting in loss of independent ambulation in childhood or adolescence. Poulton et al. (2013) emphasized the neurodegenerative phenotype of these patients and suggested that it was distinct from that reported by Shen et al. (2010). Patient fibroblasts showed increased susceptibility under stress conditions compared to controls. In 2 Portuguese sibs with ataxia-oculomotor apraxia-4 (AOA4; 616267), Bras et al. (2015) identified compound heterozygous mutations in the PNKP gene: the same 17-bp duplication in the PNKP gene identified by Shen et al. (2010) and Poulton et al. (2013), and G375W (605610.0005). Bras et al. (2015) referred to the 17-bp duplication as c.1253_1269dup, resulting in a frameshift and premature termination (Thr424GlyfsTer49) in the kinase domain. Functional studies of the variants were not performed. (less)
Pathogenic (-)	no assertion criteria provided Method: clinical testing	not provided Affected status: yes Allele origin: germline	Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen Study: VKGL Data-share Consensus Accession: SCV001741757.3 First in ClinVar: Jul 07, 2021 Last updated: Sep 08, 2021
Pathogenic (-)	no assertion criteria provided Method: clinical testing	not provided Affected status: yes Allele origin: germline	Joint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+ Additional submitter: Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen Study: VKGL Data-share Consensus Accession: SCV001953183.1 First in ClinVar: Oct 02, 2021 Last updated: Oct 02, 2021
Pathogenic (-)	no assertion criteria provided Method: clinical testing	not provided Affected status: yes Allele origin: germline	Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center Additional submitter: Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen Study: VKGL Data-share Consensus Accession: SCV001967955.1 First in ClinVar: Oct 08, 2021 Last updated: Oct 08, 2021
click to load more click to collapse

Comment:

Based on the classification scheme VCGS_Germline_v1.3.3, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism of disease in this gene and is associated with ataxia-oculomotor apraxia 4 (MIM#616267), and microcephaly, seizures, and developmental delay (MIM#613402). (I) 0106 - This gene is associated with autosomal recessive disease. (I) 0205 - Variant is predicted to result in a truncated protein (premature termination codon is NOT located at least 54 nucleotides upstream of the final exon-exon junction) with less than 1/3 of the protein sequence affected (PMID: 22508754). (SP) 0251 - This variant is heterozygous. (I) 0304 - Variant is present in gnomAD (v2) <0.01 for a recessive condition (38 heterozygotes, 0 homozygotes). (SP) 0600 - Variant results in the loss of part of the annotated AAA domain (PDB). (I) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. The variant has previously been described as pathogenic in multiple homozygous and compound heterozygous patients, with either ataxia-oculomotor apraxia 4 or microcephaly, seizures and developmental delay (ClinVar, PMID: 31436889, PMID: 31707899). (SP) 1102 - Strong phenotype match for this individual. (SP) 1201 - Heterozygous variant detected in trans with a second pathogenic heterozygous variant (p.(Ser430Lysfs*39)) in a recessive disease. (SP) 1206 - This variant has been shown to be paternally inherited (by trio analysis). (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign

Comment:

Published functional studies demonstrate a damaging effect showing that the variant reduces or eliminates PNKP DNA kinase activity (Reynolds et al., 2012); Frameshift variant in the C-terminus predicted to result in protein truncation, as the last 98 amino acids are lost and replaced with 48 incorrect amino acids (HGMD); This variant is associated with the following publications: (PMID: 23224214, 25558065, 23921166, 22508754, 25728773, 20118933, 29498415, 28333917, 30956058, 29655203, 30267214, 30214071, 31707899, 31436889, 34402213, 31589614, 31110700, 32504494)

Comment:

This sequence change creates a premature translational stop signal (p.Thr424Glyfs*49) in the PNKP gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 98 amino acid(s) of the PNKP protein. This variant is present in population databases (rs587784365, gnomAD 0.03%). This premature translational stop signal has been observed in individuals with microcephaly, early-onset, intractable seizures and developmental delay (MCSZ), ataxia with oculomotor apraxia, and progressive cerebellar atrophy and polyneuropathy (PMID: 20118933, 23224214, 25558065, 25728773). It has also been observed to segregate with disease in related individuals. This variant is also known as c.1250_1251insAACGGGTCGCCATCGAC (p.R418Tfs*55). ClinVar contains an entry for this variant (Variation ID: 4847). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this premature translational stop signal affects PNKP function (PMID: 22508754). For these reasons, this variant has been classified as Pathogenic.

Comment:

The c.1253_1269dup17 pathogenic mutation, located in coding exon 13 of the PNKP gene, results from a duplication of GGGTCGCCATCGACAAC at nucleotide position 1253, causing a translational frameshift with a predicted alternate stop codon (p.T424Gfs*49). This frameshift occurs at the 3' terminus of PNKP, is not expected to trigger nonsense-mediated mRNA decay, and impacts only the last 98 amino acids of the protein. The exact functional impact of these altered amino acids is unknown at this time. However, this variant has been reported in compound heterozygote and homozygous individuals with microcephaly, seizures and developmental delay, as well as ataxia with oculomotor apraxia type 4 (Shen J et al. Nat. Genet., 2010 Mar;42:245-9; Poulton C et al. Neurogenetics, 2013 Feb;14:43-51; Bras J et al. Am. J. Hum. Genet., 2015 Mar;96:474-9; Scholz C et al. Clin. Genet., 2018 Jul;94:185-186). This variant has also been shown to lose DNA kinase activity in functional studies (Reynolds JJ et al. Nucleic Acids Res., 2012 Aug;40:6608-19). Based on our internal structural assessment, this alteration results in loss of large parts of the polynucleotide kinase domain, including helices involved in DNA and NTP binding (Garces F et al. Mol. Cell, 2011 Nov;44:385-96). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Compound Heterozygous Mutations in PNKP Gene in an Iranian Child with Microcephaly, Seizures, and Developmental Delay.	Bitarafan F	Fetal and pediatric pathology	2021	PMID: 31707899
From congenital microcephaly to adult onset cerebellar ataxia: Distinct and overlapping phenotypes in patients with PNKP gene mutations.	Gatti M	American journal of medical genetics. Part A	2019	PMID: 31436889
Mutations in PNKP cause recessive ataxia with oculomotor apraxia type 4.	Bras J	American journal of human genetics	2015	PMID: 25728773
Accelerating novel candidate gene discovery in neurogenetic disorders via whole-exome sequencing of prescreened multiplex consanguineous families.	Alazami AM	Cell reports	2015	PMID: 25558065
Progressive cerebellar atrophy and polyneuropathy: expanding the spectrum of PNKP mutations.	Poulton C	Neurogenetics	2013	PMID: 23224214
Impact of PNKP mutations associated with microcephaly, seizures and developmental delay on enzyme activity and DNA strand break repair.	Reynolds JJ	Nucleic acids research	2012	PMID: 22508754
Mutations in PNKP cause microcephaly, seizures and defects in DNA repair.	Shen J	Nature genetics	2010	PMID: 20118933

Text-mined citations for rs587784365 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 20, 2024

ClinVar Genomic variation as it relates to human health

NM_007254.4(PNKP):c.1253_1269dup (p.Thr424fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs587784365 ...