CASZ1[gene] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 100 of 473

<< First< Prev

Page of 5

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 2664871	GRCh38/hg38 1p36.33-35.1(chr1:99125-34026935)x3	A2ML1-AS2, A3GALT2 +2151 more	Copy number gain	Trisomy 12p	GPathogenic
Select item 147521	GRCh38/hg38 1p36.33-36.22(chr1:844347-12470133)x1	ACAP3, ACOT7 +806 more	Copy number loss	See cases	GPathogenic
Select item 59846	GRCh38/hg38 1p36.32-36.13(chr1:3006193-17688934)x1	LINC02783, LINC03126 +804 more	Copy number loss	See cases	GPathogenic
Select item 148387	GRCh38/hg38 1p36.32-36.21(chr1:4898439-12911913)x1	AADACL3, AADACL4 +500 more	Copy number loss	See cases	GPathogenic
Select item 59856	GRCh38/hg38 1p36.32-36.21(chr1:4898439-13111056)x1	LOC129929435, LOC129929436 +505 more	Copy number loss	See cases	GPathogenic
Select item 154704	GRCh38/hg38 1p36.31-36.13(chr1:5363826-18360302)x1	PLOD1, PRAMEF1 +730 more	Copy number loss	See cases	GPathogenic
Select item 148885	GRCh38/hg38 1p36.31-36.21(chr1:6303641-15799093)x1	LOC129929327, LOC129929328 +557 more	Copy number loss	See cases	GPathogenic
Select item 154839	GRCh38/hg38 1p36.31-36.13(chr1:6554885-16056011)x3	AADACL3, AADACL4 +563 more	Copy number gain	See cases	GPathogenic
Select item 58051	GRCh38/hg38 1p36.31-36.21(chr1:6652339-12724844)x3	AADACL3, AADACL4 +387 more	Copy number gain	See cases	GPathogenic
Select item 59884	GRCh38/hg38 1p36.23-36.21(chr1:7165036-13111056)x1	AADACL3, AADACL4 +386 more	Copy number loss	See cases	GPathogenic
Select item 146535	GRCh38/hg38 1p36.23-36.22(chr1:8283694-12470133)x1	AGTRAP, ANGPTL7 +309 more	Copy number loss	See cases	GPathogenic
Select item 59885	GRCh38/hg38 1p36.23-36.13(chr1:9034671-16441465)x1	AADACL3, AADACL4 +462 more	Copy number loss	See cases	GPathogenic
Select item 144297	GRCh38/hg38 1p36.23-36.21(chr1:9064492-12666744)x1	AADACL4, AGTRAP +280 more	Copy number loss	See cases	GPathogenic
Select item 152293	GRCh38/hg38 1p36.22-36.21(chr1:9428538-15815791)x1	AADACL3, AADACL4 +370 more	Copy number loss	See cases	GPathogenic
Select item 1707471	NC_000001.11:g.10115497_16283149dup	LOC110120623, LOC110120648 +361 more	Duplication	not specified	GLikely pathogenic
Select item 148364	GRCh38/hg38 1p36.22(chr1:10245412-10637093)x1	CENPS, CENPS-CORT +30 more	Copy number loss	See cases	GLikely pathogenic
Select item 152937	GRCh38/hg38 1p36.22-36.21(chr1:10264397-15780840)x1	AADACL3, AADACL4 +304 more	Copy number loss	See cases	GPathogenic
Select item 153433	GRCh38/hg38 1p36.22(chr1:10317912-11018880)x4	C1orf127, CASZ1 +48 more	Copy number gain	See cases	GUncertain significance
Select item 59892	GRCh38/hg38 1p36.22-36.13(chr1:10621776-16520709)x1	AADACL3, AADACL4 +337 more	Copy number loss	See cases	GPathogenic
Select item 151329	GRCh38/hg38 1p36.22(chr1:10637036-10743996)x3	CASZ1, LOC110120648 +8 more	Copy number gain	See cases	GBenign
Select item 144806	GRCh38/hg38 1p36.22(chr1:10637036-10693021)x3	CASZ1, LOC110120648 +1 more	Copy number gain	See cases	GBenign
Select item 57720	GRCh38/hg38 1p36.22(chr1:10637036-11293430)x3	ANGPTL7, C1orf127 +43 more	Copy number gain	See cases	GUncertain significance
Select item 1243264	NM_001079843.3(CASZ1):c.25_30dup	CASZ1	Duplication (3 prime UTR variant)	not provided	GBenign
Select item 1390320	NM_001079843.3(CASZ1):c.5276C>T (p.Pro1759Leu)	CASZ1 (P1759L)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1541033	NM_001079843.3(CASZ1):c.5271C>T (p.Ser1757=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1942623	NM_001079843.3(CASZ1):c.5268C>G (p.Ala1756=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2284769	NM_001079843.3(CASZ1):c.5260A>T (p.Thr1754Ser)	CASZ1 (T1754S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2885874	NM_001079843.3(CASZ1):c.5243C>A (p.Ala1748Asp)	CASZ1 (A1748D)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 3263518	NM_001079843.3(CASZ1):c.5240G>A (p.Gly1747Asp)	CASZ1 (G1747D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2386871	NM_001079843.3(CASZ1):c.5237T>C (p.Leu1746Pro)	CASZ1 (L1746P)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2755533	NM_001079843.3(CASZ1):c.5234C>G (p.Ala1745Gly)	CASZ1 (A1745G)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 3137737	NM_001079843.3(CASZ1):c.5225C>T (p.Ala1742Val)	CASZ1 (A1742V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1294667	NM_001079843.3(CASZ1):c.5213C>G (p.Pro1738Arg)	CASZ1 (P1738R)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 1416792	NM_001079843.3(CASZ1):c.5207G>A (p.Arg1736Gln)	CASZ1 (R1736Q)	Single nucleotide variant (missense variant)	not specified +1 more	GUncertain significance
Select item 1591710	NM_001079843.3(CASZ1):c.5205G>A (p.Ala1735=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2024112	NM_001079843.3(CASZ1):c.5169G>T (p.Leu1723=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2303729	NM_001079843.3(CASZ1):c.5164T>C (p.Ser1722Pro)	CASZ1 (S1722P)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2304950	NM_001079843.3(CASZ1):c.5162A>C (p.Glu1721Ala)	CASZ1 (E1721A)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2492032	NM_001079843.3(CASZ1):c.5155T>C (p.Ser1719Pro)	CASZ1 (S1719P)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2160262	NM_001079843.3(CASZ1):c.5154C>A (p.Asp1718Glu)	CASZ1 (D1718E)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 2056158	NM_001079843.3(CASZ1):c.5089GACGACGAGGACGACGACGACGAGGAC[1] (p.1697DDEDDDDED[1])	CASZ1	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 1481790	NM_001079843.3(CASZ1):c.5113GACGACGACGAGGAC[1] (p.1705DDDED[1])	CASZ1	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 1983227	NM_001079843.3(CASZ1):c.5127CGA[5] (p.Asp1712_Glu1713insAsp)	CASZ1	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 1225114	NM_001079843.3(CASZ1):c.5127CGA[2] (p.Asp1711_Asp1712del)	CASZ1	Microsatellite (inframe_deletion)	not provided	GBenign
Select item 2894551	NM_001079843.3(CASZ1):c.5112GGACGACGACGA[3] (p.Asp1711_Asp1712insGluAspAspAsp)	CASZ1	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 774786	NM_001079843.3(CASZ1):c.5112GGACGACGACGA[1] (p.1704EDDD[1])	CASZ1	Microsatellite (inframe_deletion)	not provided	GLikely benign
Select item 1391878	NM_001079843.3(CASZ1):c.5094CGAGGACGACGACGA[1] (p.1698DEDDD[1])	CASZ1	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 2490049	NM_001079843.3(CASZ1):c.5122G>A (p.Glu1708Lys)	CASZ1 (E1708K)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2483151	NM_001079843.3(CASZ1):c.5121C>A (p.Asp1707Glu)	CASZ1 (D1707E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1381212	NM_001079843.3(CASZ1):c.5100CGA[1] (p.Asp1701_Asp1703del)	CASZ1	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 2704621	NM_001079843.3(CASZ1):c.5110G>A (p.Glu1704Lys)	CASZ1 (E1704K)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1501069	NM_001079843.3(CASZ1):c.5085GGACGACGACGA[1] (p.1695EDDD[1])	CASZ1	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 1499950	NM_001079843.3(CASZ1):c.5106C>G (p.Asp1702Glu)	CASZ1 (D1702E)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2724541	NM_001079843.3(CASZ1):c.5085_5102dup (p.Asp1700_Asp1701insGluAspAspAspGluAsp)	CASZ1	Duplication (inframe_insertion)	not provided	GUncertain significance
Select item 2306681	NM_001079843.3(CASZ1):c.5103C>G (p.Asp1701Glu)	CASZ1 (D1701E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2371042	NM_001079843.3(CASZ1):c.5102A>G (p.Asp1701Gly)	CASZ1 (D1701G)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2368527	NM_001079843.3(CASZ1):c.5091C>G (p.Asp1697Glu)	CASZ1 (D1697E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1633553	NM_001079843.3(CASZ1):c.5079GGACGA[4] (p.1693ED[4])	CASZ1	Microsatellite (inframe_insertion)	not provided	GLikely benign
Select item 787205	NM_001079843.3(CASZ1):c.5079GGACGA[1] (p.1693ED[1])	CASZ1	Microsatellite (inframe_deletion)	not provided	GLikely benign
Select item 3137735	NM_001079843.3(CASZ1):c.5053C>T (p.Pro1685Ser)	CASZ1 (P1685S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3137734	NM_001079843.3(CASZ1):c.5032G>A (p.Glu1678Lys)	CASZ1 (E1678K)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2060892	NM_001079843.3(CASZ1):c.4986CGC[8] (p.Ala1670_Gly1671insAla)	CASZ1	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 2170113	NM_001079843.3(CASZ1):c.5004C>G (p.Ala1668=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2749738	NM_001079843.3(CASZ1):c.5001C>T (p.Ala1667=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2722326	NM_001079843.3(CASZ1):c.4969_4998del (p.Pro1657_Ala1666del)	CASZ1	Deletion (inframe_deletion)	not provided	GUncertain significance
Select item 3017551	NM_001079843.3(CASZ1):c.4969_4995del (p.Pro1657_Ala1665del)	CASZ1	Deletion (inframe_deletion)	not provided	GUncertain significance
Select item 1635408	NM_001079843.3(CASZ1):c.4977G>A (p.Pro1659=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2638204	NM_001079843.3(CASZ1):c.4948G>T (p.Gly1650Cys)	CASZ1 (G1650C)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1580310	NM_001079843.3(CASZ1):c.4947C>T (p.Pro1649=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 3137732	NM_001079843.3(CASZ1):c.4940G>A (p.Gly1647Asp)	CASZ1 (G1647D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2973177	NM_001079843.3(CASZ1):c.4922T>A (p.Leu1641Gln)	CASZ1 (L1641Q)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2638205	NM_001079843.3(CASZ1):c.4905G>T (p.Ala1635=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2918018	NM_001079843.3(CASZ1):c.4888C>G (p.Leu1630Val)	CASZ1 (L1630V)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1648749	NM_001079843.3(CASZ1):c.4878G>C (p.Pro1626=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1601815	NM_001079843.3(CASZ1):c.4878G>T (p.Pro1626=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 1399629	NM_001079843.3(CASZ1):c.4873G>A (p.Glu1625Lys)	CASZ1 (E1625K)	Single nucleotide variant (missense variant)	not specified +1 more	GUncertain significance
Select item 3001681	NM_001079843.3(CASZ1):c.4869C>T (p.Gly1623=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1898206	NM_001079843.3(CASZ1):c.4835C>T (p.Pro1612Leu)	CASZ1 (P1612L)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2066820	NM_001079843.3(CASZ1):c.4834C>T (p.Pro1612Ser)	CASZ1 (P1612S)	Single nucleotide variant (missense variant)	not specified +1 more	GUncertain significance
Select item 3367732	NM_001079843.3(CASZ1):c.4828_4831dup (p.Gly1611fs)	CASZ1 (G1611fs)	Duplication (frameshift variant)	not provided	GUncertain significance
Select item 2076326	NM_001079843.3(CASZ1):c.4827G>C (p.Ala1609=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2262833	NM_001079843.3(CASZ1):c.4817A>C (p.Glu1606Ala)	CASZ1 (E1606A)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3137731	NM_001079843.3(CASZ1):c.4757C>T (p.Ser1586Leu)	CASZ1 (S1586L)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2757862	NM_001079843.3(CASZ1):c.4692C>T (p.Tyr1564=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2479190	NM_001079843.3(CASZ1):c.4660A>G (p.Ser1554Gly)	CASZ1 (S1554G)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3020694	NM_001079843.3(CASZ1):c.4645T>C (p.Cys1549Arg)	CASZ1 (C1549R)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2715083	NM_001079843.3(CASZ1):c.4635C>T (p.Ala1545=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2638206	NM_001079843.3(CASZ1):c.4617A>G (p.Lys1539=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2610298	NM_001079843.3(CASZ1):c.4565T>A (p.Phe1522Tyr)	CASZ1 (F1522Y)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1664278	NM_001079843.3(CASZ1):c.4539G>T (p.Thr1513=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 1614742	NM_001079843.3(CASZ1):c.4539G>C (p.Thr1513=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2884984	NM_001079843.3(CASZ1):c.4519C>G (p.Pro1507Ala)	CASZ1 (P1507A)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 3137729	NM_001079843.3(CASZ1):c.4505A>T (p.His1502Leu)	CASZ1 (H1502L)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1954491	NM_001079843.3(CASZ1):c.4449C>T (p.Arg1483=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1988231	NM_001079843.3(CASZ1):c.4395C>G (p.Gly1465=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1357480	NM_001079843.3(CASZ1):c.4352dup (p.Leu1452fs)	CASZ1 (L1452fs)	Duplication (frameshift variant)	not provided	GUncertain significance
Select item 2547998	NM_001079843.3(CASZ1):c.4287G>C (p.Met1429Ile)	CASZ1 (M1429I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2903711	NM_001079843.3(CASZ1):c.4256C>T (p.Ala1419Val)	CASZ1 (A1419V)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2898209	NM_001079843.3(CASZ1):c.4236C>T (p.Phe1412=)	CASZ1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1599392	NM_001079843.3(CASZ1):c.4235T>G (p.Phe1412Cys)	CASZ1 (F1412C)	Single nucleotide variant (missense variant)	not provided	GBenign

<< First< Prev

Page of 5