RASA2[gene] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 100 of 669

<< First< Prev

Page of 7

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 154258	GRCh38/hg38 3q11.1-24(chr3:93800620-145695381)x3	PDIA5, PHLDB2 +1344 more	Copy number gain	See cases	GPathogenic
Select item 145614	GRCh38/hg38 3q13.11-29(chr3:103426882-198110178)x3	LOC115995524, LOC115995525 +2647 more	Copy number gain	See cases	GPathogenic
Select item 147358	GRCh38/hg38 3q22.1-24(chr3:129817243-143381624)x1	A4GNT, ACAD11 +345 more	Copy number loss	See cases	GPathogenic
Select item 155567	GRCh38/hg38 3q22.1-24(chr3:132716978-144784743)x1	A4GNT, AMOTL2 +301 more	Copy number loss	See cases	GPathogenic
Select item 149077	GRCh38/hg38 3q22.2-25.1(chr3:134257180-149729538)x1	LOC129937630, LOC129937631 +320 more	Copy number loss	See cases	GPathogenic
Select item 151765	GRCh38/hg38 3q22.2-23(chr3:134333553-141701458)x1	A4GNT, AMOTL2 +167 more	Copy number loss	See cases	GPathogenic
Select item 57832	GRCh38/hg38 3q22.2-24(chr3:135227451-145870770)x1	A4GNT, ARMC8 +221 more	Copy number loss	See cases	GPathogenic
Select item 145313	GRCh38/hg38 3q22.3-24(chr3:137932000-144468739)x1	A4GNT, ARMC8 +171 more	Copy number loss	See cases	GPathogenic
Select item 150251	GRCh38/hg38 3q22.3-24(chr3:137991123-143618786)x1	A4GNT, ARMC8 +155 more	Copy number loss	See cases	GPathogenic
Select item 929178	NM_006506.5(RASA2):c.-15G>C	LOC129937686, RASA2	Single nucleotide variant (5 prime UTR variant)	not specified	GUncertain significance
Select item 917600	NM_006506.5(RASA2):c.-15G>T	LOC129937686, RASA2	Single nucleotide variant (5 prime UTR variant)	not specified	GUncertain significance
Select item 3339801	NM_006506.5(RASA2):c.-6G>A	LOC129937686, RASA2	Single nucleotide variant (5 prime UTR variant)	not specified	GUncertain significance
Select item 3004664	NM_006506.5(RASA2):c.3_23dup (p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla)	LOC129937686, RASA2	Duplication (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 1315735	NM_006506.5(RASA2):c.4GCG[5] (p.Ala5dup)	LOC129937686, RASA2	Microsatellite (inframe_insertion +1 more)	not provided	GConflicting classifications of pathogenicity
Select item 1416563	NM_006506.5(RASA2):c.12GGCGCCTGCTGCTGCGGCGGC[3] (p.5APAAAAA[3])	LOC129937686, RASA2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 1317345	NM_006506.5(RASA2):c.12_32dup (p.Ala5_Ala11dup)	LOC129937686, RASA2	Duplication (inframe_insertion)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 1432016	NM_006506.5(RASA2):c.5C>T (p.Ala2Val)	LOC129937686, RASA2 (A2V)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2727324	NM_006506.5(RASA2):c.6_7delinsAT (p.Ala3Ser)	LOC129937686, RASA2 (A3S)	Indel (missense variant)	not provided	GUncertain significance
Select item 2421860	NM_006506.5(RASA2):c.15_32dup (p.Ala11_Ser12insProAlaAlaAlaAlaAla)	LOC129937686, RASA2	Duplication (inframe_insertion)	not provided	GUncertain significance
Select item 2966950	NM_006506.5(RASA2):c.16_30dup (p.Ala10_Ala11insProAlaAlaAlaAla)	LOC129937686, RASA2	Duplication (inframe_insertion)	not provided	GUncertain significance
Select item 1948724	NM_006506.5(RASA2):c.9G>T (p.Ala3=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1747076	NM_006506.5(RASA2):c.11C>T (p.Ala4Val)	LOC129937686, RASA2 (A4V)	Single nucleotide variant (missense variant)	not specified +1 more	GUncertain significance
Select item 1769363	NM_006506.5(RASA2):c.12G>A (p.Ala4=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 3225602	NM_006506.5(RASA2):c.13G>A (p.Ala5Thr)	LOC129937686, RASA2 (A5T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2562694	NM_006506.5(RASA2):c.13G>C (p.Ala5Pro)	LOC129937686, RASA2 (A5P)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1451069	NM_006506.5(RASA2):c.15_17dup (p.Pro6dup)	LOC129937686, RASA2	Duplication (inframe_insertion)	not provided	GUncertain significance
Select item 2722034	NM_006506.5(RASA2):c.14C>G (p.Ala5Gly)	LOC129937686, RASA2 (A5G)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1977784	NM_006506.5(RASA2):c.15G>A (p.Ala5=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 218684	NM_006506.5(RASA2):c.17C>T (p.Pro6Leu)	LOC129937686, RASA2 (P6L)	Single nucleotide variant (missense variant)	not specified +1 more	GConflicting classifications of pathogenicity
Select item 2812527	NM_006506.5(RASA2):c.19G>C (p.Ala7Pro)	LOC129937686, RASA2 (A7P)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1792239	NM_006506.5(RASA2):c.24T>G (p.Ala8=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 1793656	NM_006506.5(RASA2):c.25G>T (p.Ala9Ser)	LOC129937686, RASA2 (A9S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 929175	NM_006506.5(RASA2):c.26C>T (p.Ala9Val)	RASA2, LOC129937686 (A9V)	Single nucleotide variant (missense variant)	not specified +1 more	GBenign/Likely benign
Select item 3312837	NM_006506.5(RASA2):c.27G>C (p.Ala9=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 1796200	NM_006506.5(RASA2):c.27G>T (p.Ala9=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 1796182	NM_006506.5(RASA2):c.27G>A (p.Ala9=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not specified +1 more	GLikely benign
Select item 1384259	NM_006506.5(RASA2):c.29C>T (p.Ala10Val)	LOC129937686, RASA2 (A10V)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1732058	NM_006506.5(RASA2):c.34T>A (p.Ser12Thr)	LOC129937686, RASA2 (S12T)	Single nucleotide variant (missense variant)	not provided +1 more	GUncertain significance
Select item 1492892	NM_006506.5(RASA2):c.35C>T (p.Ser12Phe)	LOC129937686, RASA2 (S12F)	Single nucleotide variant (missense variant)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 1461381	NM_006506.5(RASA2):c.45_77dup (p.Pro16_Ala26dup)	LOC129937686, RASA2	Duplication (inframe_insertion)	not provided	GUncertain significance
Select item 1217253	NM_006506.5(RASA2):c.37T>G (p.Ser13Ala)	LOC129937686, RASA2 (S13A)	Single nucleotide variant (missense variant)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 933185	NM_006506.5(RASA2):c.38C>T (p.Ser13Phe)	RASA2, LOC129937686 (S13F)	Single nucleotide variant (missense variant)	not specified +1 more	GConflicting classifications of pathogenicity
Select item 2691474	NM_006506.5(RASA2):c.48del (p.Ala17fs)	LOC129937686, RASA2 (A17fs)	Deletion (frameshift variant)	not specified	GUncertain significance
Select item 1743924	NM_006506.5(RASA2):c.48A>G (p.Pro16=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 2506327	NM_006506.5(RASA2):c.49del (p.Ala17fs)	LOC129937686, RASA2 (A17fs)	Deletion (frameshift variant)	not specified	GUncertain significance
Select item 1745337	NM_006506.5(RASA2):c.50C>T (p.Ala17Val)	LOC129937686, RASA2 (A17V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2958120	NM_006506.5(RASA2):c.53C>T (p.Ala18Val)	LOC129937686, RASA2 (A18V)	Single nucleotide variant (missense variant)	not specified +1 more	GUncertain significance
Select item 2534517	NM_006506.5(RASA2):c.56G>C (p.Ser19Thr)	LOC129937686, RASA2 (S19T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3339861	NM_006506.5(RASA2):c.60G>T (p.Ala20=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 1753336	NM_006506.5(RASA2):c.63T>G (p.Thr21=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 3003408	NM_006506.5(RASA2):c.70C>A (p.Pro24Thr)	LOC129937686, RASA2 (P24T)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 932208	NM_006506.5(RASA2):c.71C>T (p.Pro24Leu)	LOC129937686, RASA2 (P24L)	Single nucleotide variant (missense variant)	not specified +1 more	GUncertain significance
Select item 1758180	NM_006506.5(RASA2):c.72C>G (p.Pro24=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 1758178	NM_006506.5(RASA2):c.72C>A (p.Pro24=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 733861	NM_006506.5(RASA2):c.78C>G (p.Ala26=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2728112	NM_006506.5(RASA2):c.80G>T (p.Gly27Val)	LOC129937686, RASA2 (G27V)	Single nucleotide variant (missense variant)	not specified +1 more	GUncertain significance
Select item 1765051	NM_006506.5(RASA2):c.88G>T (p.Asp30Tyr)	LOC129937686, RASA2 (D30Y)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1765788	NM_006506.5(RASA2):c.90C>T (p.Asp30=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 2115479	NM_006506.5(RASA2):c.92G>A (p.Ser31Asn)	LOC129937686, RASA2 (S31N)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2447625	NM_006506.5(RASA2):c.93T>G (p.Ser31Arg)	LOC129937686, RASA2 (S31R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1394839	NM_006506.5(RASA2):c.94C>G (p.Arg32Gly)	LOC129937686, RASA2 (R32G)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1065133	NM_006506.5(RASA2):c.108G>A (p.Val36=)	RASA2, LOC129937686	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 1744524	NM_006506.5(RASA2):c.118C>T (p.Leu40=)	LOC129937686, RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 1396106	NM_006506.5(RASA2):c.122G>A (p.Arg41Gln)	LOC129937686, RASA2 (R41Q)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2625076	NM_006506.5(RASA2):c.124G>A (p.Gly42Ser)	LOC129937686, RASA2 (G42S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1352435	NM_006506.5(RASA2):c.124G>T (p.Gly42Cys)	LOC129937686, RASA2 (G42C)	Single nucleotide variant (missense variant)	not specified +1 more	GUncertain significance
Select item 3225601	NM_006506.5(RASA2):c.131T>C (p.Ile44Thr)	LOC129937686, RASA2 (I44T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1683321	NM_006506.5(RASA2):c.133+9G>A	LOC129937686, RASA2	Single nucleotide variant (intron variant)	not provided +1 more	GLikely benign
Select item 1098778	NM_006506.5(RASA2):c.133+10G>A	LOC129937686, RASA2	Single nucleotide variant (intron variant)	not specified +1 more	GConflicting classifications of pathogenicity
Select item 1260845	NM_006506.5(RASA2):c.134-106del	RASA2	Deletion (intron variant)	not provided	GBenign
Select item 2873607	NM_006506.5(RASA2):c.134-10A>G	RASA2	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1441847	NM_006506.5(RASA2):c.134-7C>G	RASA2	Single nucleotide variant (intron variant)	not provided	GUncertain significance
Select item 2706641	NM_006506.5(RASA2):c.140C>A (p.Ala47Glu)	RASA2 (A47E)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1773757	NM_006506.5(RASA2):c.148T>G (p.Leu50Val)	RASA2 (L50V)	Single nucleotide variant (missense variant)	not specified +1 more	GUncertain significance
Select item 1774150	NM_006506.5(RASA2):c.150A>G (p.Leu50=)	RASA2	Single nucleotide variant (synonymous variant)	not provided +1 more	GLikely benign
Select item 1177273	NM_006506.5(RASA2):c.156A>G (p.Pro52=)	RASA2	Single nucleotide variant (synonymous variant)	not specified +1 more	GLikely benign
Select item 1775676	NM_006506.5(RASA2):c.157T>G (p.Tyr53Asp)	RASA2 (Y53D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1777427	NM_006506.5(RASA2):c.165A>G (p.Gly55=)	RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 1989380	NM_006506.5(RASA2):c.182A>G (p.Asp61Gly)	RASA2 (D61G)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1592895	NM_006506.5(RASA2):c.186T>C (p.Cys62=)	RASA2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2496762	NM_006506.5(RASA2):c.195C>T (p.Thr65=)	RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 1785036	NM_006506.5(RASA2):c.204G>A (p.Leu68=)	RASA2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 2976785	NM_006506.5(RASA2):c.211G>A (p.Glu71Lys)	RASA2 (E71K)	Single nucleotide variant (missense variant)	not provided +1 more	GUncertain significance
Select item 2819619	NM_006506.5(RASA2):c.223C>G (p.Arg75Gly)	RASA2 (R75G)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1788248	NM_006506.5(RASA2):c.223C>T (p.Arg75Cys)	RASA2 (R75C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1497258	NM_006506.5(RASA2):c.224G>A (p.Arg75His)	RASA2 (R75H)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1924593	NM_006506.5(RASA2):c.225T>C (p.Arg75=)	RASA2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2627326	NM_006506.5(RASA2):c.248T>G (p.Leu83Ter)	RASA2 (L83*)	Single nucleotide variant (nonsense)	not provided +1 more	GUncertain significance
Select item 2067648	NM_006506.5(RASA2):c.251+15T>A	RASA2	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 2706882	NM_006506.5(RASA2):c.251+16T>C	RASA2	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1246456	NM_006506.5(RASA2):c.252-277_252-275del	RASA2	Deletion (intron variant)	not provided	GBenign
Select item 1318191	NM_006506.5(RASA2):c.252-264G>C	RASA2	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1240904	NM_006506.5(RASA2):c.252-249A>C	RASA2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1316804	NM_006506.5(RASA2):c.252-244_252-242del	RASA2	Deletion (intron variant)	not provided	GLikely benign
Select item 496326	NM_006506.5(RASA2):c.252-18C>G	RASA2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 992229	NM_006506.5(RASA2):c.255A>G (p.Pro85=)	RASA2	Single nucleotide variant (synonymous variant)	not specified +1 more	GLikely benign
Select item 3225605	NM_006506.5(RASA2):c.277T>C (p.Phe93Leu)	RASA2 (F93L)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 929180	NM_006506.5(RASA2):c.286C>A (p.Pro96Thr)	RASA2 (P96T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1797780	NM_006506.5(RASA2):c.292A>G (p.Thr98Ala)	RASA2 (T98A)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1414310	NM_006506.5(RASA2):c.292A>C (p.Thr98Pro)	RASA2 (T98P)	Single nucleotide variant (missense variant)	not provided	GUncertain significance

<< First< Prev

Page of 7