U.S. flag

An official website of the United States government

NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs) AND Ectopia lentis et pupillae

Germline classification:
Pathogenic (4 submissions)
Last evaluated:
Apr 11, 2023
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV000032753.10

Allele description [Variation Report for NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs)]

NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs)

Genes:
ADAMTSL4:ADAMTS like 4 [Gene - OMIM - HGNC]
ADAMTSL4-AS2:ADAMTSL4 antisense RNA 2 [Gene - HGNC]
Variant type:
Deletion
Cytogenetic location:
1q21.2
Genomic location:
Preferred name:
NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs)
HGVS:
  • NC_000001.11:g.150553758_150553777del
  • NG_012172.1:g.9337_9356del
  • NM_001288607.2:c.767_786del
  • NM_001288608.2:c.767_786del
  • NM_001378596.1:c.767_786del
  • NM_019032.6:c.767_786delMANE SELECT
  • NM_025008.5:c.767_786del
  • NP_001275536.1:p.Gln256fs
  • NP_001275537.1:p.Gln256fs
  • NP_001365525.1:p.Gln256fs
  • NP_061905.2:p.Gln256fs
  • NP_079284.2:p.Gln256fs
  • NC_000001.10:g.150526226_150526245del
  • NC_000001.10:g.150526234_150526253del
  • NC_000001.11:g.150553750_150553769delCAGAGCCCAGGCCTCTGGCA
  • NM_019032.4:c.767_786del
  • NM_019032.4:c.767_786delAGGCCTCTGGCACAGAGCCC
  • NM_019032.5:c.767_786delAGGCCTCTGGCACAGAGCCC
  • p.Gln256ProfsX38
Protein change:
Q256fs
Links:
OMIM: 610113.0003; dbSNP: rs199473693
NCBI 1000 Genomes Browser:
rs199473693

Condition(s)

Name:
Ectopia lentis et pupillae
Synonyms:
ECTOPIA LENTIS WITH ECTOPIA OF PUPIL
Identifiers:
MONDO: MONDO:0009153; MedGen: C1644196; Orphanet: 1885; OMIM: 225200

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000056517OMIM
no assertion criteria provided
Pathogenic
(Jul 24, 2012)
germlineliterature only

PubMed (4)
[See all records that cite these PMIDs]

SCV001749619GenomeConnect - Invitae Patient Insights Network
no classification provided
not providedunknownphenotyping only

SCV002586999GeneReviews
no classification provided
not providedgermlineliterature only

PubMed (5)
[See all records that cite these PMIDs]

SCV004049170Genome-Nilou Lab
criteria provided, single submitter

(ACMG Guidelines, 2015)
Pathogenic
(Apr 11, 2023)
germlineclinical testing

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlinenot providednot providednot providednot providednot providednot providedliterature only
not providedgermlineunknownnot providednot providednot providednot providednot providedliterature only
not providedunknownunknownnot providednot providednot providednot providednot providedphenotyping only
not providedgermlinenonot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Role of ADAMTSL4 mutations in FBN1 mutation-negative ectopia lentis patients.

Aragon-Martin JA, Ahnood D, Charteris DG, Saggar A, Nischal KK, Comeglio P, Chandra A, Child AH, Arno G.

Hum Mutat. 2010 Aug;31(8):E1622-31. doi: 10.1002/humu.21305.

PubMed [citation]
PMID:
20564469

A novel ADAMTSL4 mutation in autosomal recessive ectopia lentis et pupillae.

Christensen AE, Fiskerstrand T, Knappskog PM, Boman H, Rødahl E.

Invest Ophthalmol Vis Sci. 2010 Dec;51(12):6369-73. doi: 10.1167/iovs.10-5597. Epub 2010 Aug 11.

PubMed [citation]
PMID:
20702823
See all PubMed Citations (6)

Details of each submission

From OMIM, SCV000056517.3

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedliterature only PubMed (4)

Description

In 10 affected individuals from 5 Norwegian families with ectopia lentis et pupillae (225200), Christensen et al. (2010) identified homozygosity for a 20-bp deletion (767_786del20) in the ADAMTSL4 gene, causing a frameshift predicted to result in a stop codon and premature termination 113 bp downstream. RT-PCR analysis of ADAMTSL4 mRNA confirmed the presence of a transcript truncated by 20 bp. Obligate heterozygotes had no ocular abnormalities. Homozygosity mapping in the 5 Norwegian families from Hordaland County in western Norway was compatible with a common ancestor 150 generations (4,000 years) earlier, and the mutation was found in heterozygosity in 3 of 190 local blood donors, corresponding to a prevalence for homozygosity of approximately 1:16,000 in this population. In 1 family, 1 of the 3 affected individuals had bilateral downward dislocation of the lenses but normally positioned pupils.

In a 15-year-old boy with isolated ectopia lentis (ECTOL2; 252100), Aragon-Martin et al. (2010) identified homozygosity for the 20-bp deletion in exon 6 of the ADAMTSL4 gene. The 20-bp deletion was also identified in compound heterozygosity with an 11-bp deletion (826_836del11; 610113.0004) in ADAMTSL4 in 2 affected members of a Caucasian British family with ectopia lentis and in an 8-year-old Swedish boy with ectopia lentis et pupillae.

In 8 patients from 7 German families with isolated ectopia lentis, Neuhann et al. (2011) identified homozygosity for the 20-bp deletion in the ADAMTSL4 gene, which they designated 759_778del20. The mutation was found in heterozygosity in unaffected parents and sibs, as well as in 2 of 360 controls. A 4-SNP haplotype was consistently associated with the mutation, suggestive of a founder mutation.

In 6 Caucasian British patients with isolated ectopia lentis, Chandra et al. (2012) identified homozygosity for the ADAMTSL4 20-bp deletion (Gln256ProfsTer38). Two more Caucasian British patients, 1 with isolated ectopia lentis and 1 with ectopia lentis et pupillae, were found to be compound heterozygous for the 20-bp deletion and 2 different frameshift mutations: a 1-bp deletion (237delC, Pro80ArgfsTer53; 610113.0006) and a 1-bp duplication (2270dupG, Gly758TrpfsTer59; 610113.0007), respectively, in the ADAMTSL4 gene.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlinenot providednot providednot providednot providednot providednot providednot providednot provided

From GenomeConnect - Invitae Patient Insights Network, SCV001749619.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedphenotyping onlynot provided

Description

Variant interpreted as Pathogenic and reported on 06-26-2017 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1unknownunknownnot providednot providednot providednot providednot providednot providednot provided

From GeneReviews, SCV002586999.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedliterature only PubMed (5)
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

From Genome-Nilou Lab, SCV004049170.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlinenonot providednot providednot providednot providednot providednot providednot provided

Last Updated: Jun 23, 2024