U.S. flag

An official website of the United States government

NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs) AND Ectopia lentis

Germline classification:
Pathogenic (1 submission)
Last evaluated:
Nov 14, 2014
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV000844602.5

Allele description [Variation Report for NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs)]

NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs)

Genes:
ADAMTSL4:ADAMTS like 4 [Gene - OMIM - HGNC]
ADAMTSL4-AS2:ADAMTSL4 antisense RNA 2 [Gene - HGNC]
Variant type:
Deletion
Cytogenetic location:
1q21.2
Genomic location:
Preferred name:
NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs)
HGVS:
  • NC_000001.11:g.150553758_150553777del
  • NG_012172.1:g.9337_9356del
  • NM_001288607.2:c.767_786del
  • NM_001288608.2:c.767_786del
  • NM_001378596.1:c.767_786del
  • NM_019032.6:c.767_786delMANE SELECT
  • NM_025008.5:c.767_786del
  • NP_001275536.1:p.Gln256fs
  • NP_001275537.1:p.Gln256fs
  • NP_001365525.1:p.Gln256fs
  • NP_061905.2:p.Gln256fs
  • NP_079284.2:p.Gln256fs
  • NC_000001.10:g.150526226_150526245del
  • NC_000001.10:g.150526234_150526253del
  • NC_000001.11:g.150553750_150553769delCAGAGCCCAGGCCTCTGGCA
  • NM_019032.4:c.767_786del
  • NM_019032.4:c.767_786delAGGCCTCTGGCACAGAGCCC
  • NM_019032.5:c.767_786delAGGCCTCTGGCACAGAGCCC
  • p.Gln256ProfsX38
Protein change:
Q256fs
Links:
OMIM: 610113.0003; dbSNP: rs199473693
NCBI 1000 Genomes Browser:
rs199473693
Observations:
2

Condition(s)

Name:
Ectopia lentis
Identifiers:
MedGen: C0013581; Human Phenotype Ontology: HP:0001083

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000245573Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
criteria provided, single submitter

(LMM Criteria)
Pathogenic
(Nov 14, 2014)
germlineclinical testing

PubMed (5)
[See all records that cite these PMIDs]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlinenot provided22not providednot providednot providedclinical testing

Citations

PubMed

A novel ADAMTSL4 mutation in autosomal recessive ectopia lentis et pupillae.

Christensen AE, Fiskerstrand T, Knappskog PM, Boman H, Rødahl E.

Invest Ophthalmol Vis Sci. 2010 Dec;51(12):6369-73. doi: 10.1167/iovs.10-5597. Epub 2010 Aug 11.

PubMed [citation]
PMID:
20702823

Role of ADAMTSL4 mutations in FBN1 mutation-negative ectopia lentis patients.

Aragon-Martin JA, Ahnood D, Charteris DG, Saggar A, Nischal KK, Comeglio P, Chandra A, Child AH, Arno G.

Hum Mutat. 2010 Aug;31(8):E1622-31. doi: 10.1002/humu.21305.

PubMed [citation]
PMID:
20564469
See all PubMed Citations (5)

Details of each submission

From Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine, SCV000245573.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not provided2not providednot providedclinical testing PubMed (5)

Description

The p.Gln256ProfsX38 variant in ADAMTSL4 has been reported in >20 compound heter ozygous or homozygous individuals with ectopia lentis and was found to segregate with disease in 6 affected relatives from 5 families (Aragon -Martin 2010, Chri stensen 2010, Neuhann 2011, Chandra 2013, Overwater 2017). The p.Gln256ProfsX38 variant has been identified in 0.24% (306/126278) of European chromosomes by the Genome Aggregation Database (gnomAD, http://gnomad.broadinstitute.org/; dbSNP r s199473693). Although this variant has been seen in the general population, its frequency is low enough to be consistent with a recessive carrier frequency. Thi s variant is predicted to cause a frameshift, which alters the protein?s amino a cid sequence beginning at position 256 and leads to a premature termination codo n 38 amino acids downstream. This alteration has been shown to lead to a truncat ed mRNA (Christensen 2010) and is predicted to lead to a truncated or absent pro tein. Complete loss-of-function of the ADAMTSL4 gene is an established disease m echanism in individuals with ectopia lentis. In summary, this variant meets our criteria to be classified as pathogenic for ectopia lentis in an autosomal reces sive manner based upon segregation studies and the impact of the variant. ACMG/A MP Criteria applied: PVS1; PM3_Very strong; PP1_Moderate.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlinenot providednot providednot providednot provided2not provided2not provided

Last Updated: May 12, 2024