NM_003052.5(SLC34A1):c.272_292del (p.Val91_Ala97del) AND not provided

Germline classification:: Conflicting interpretations of pathogenicity (4 submissions)
Last evaluated:: Mar 1, 2024
Review status:: criteria provided, conflicting classifications

Somatic classification of clinical impact:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Somatic classification of oncogenicity:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Record status:: current
Accession:: RCV000951080.18

Allele description [Variation Report for NM_003052.5(SLC34A1):c.272_292del (p.Val91_Ala97del)]

NM_003052.5(SLC34A1):c.272_292del (p.Val91_Ala97del)

Gene:

SLC34A1:solute carrier family 34 member 1 [Gene - OMIM - HGNC]

Variant type:

Deletion

Cytogenetic location:

5q35.3

Genomic location:

Preferred name:

NM_003052.5(SLC34A1):c.272_292del (p.Val91_Ala97del)

Other names:

p.Val91_Ala97del

HGVS:

NC_000005.10:g.177386233_177386253del
NG_016223.1:g.6803_6823del
NM_001167579.2:c.272_292del
NM_003052.5:c.272_292delMANE SELECT
NP_001161051.1:p.Val91_Ala97del
NP_003043.3:p.Val91_Ala97del
NC_000005.9:g.176813233_176813253del
NC_000005.9:g.176813234_176813254del
NM_003052.4:c.272_292del
NM_003052.4:c.272_292del21
NM_003052.4:c.272_292delTCCCCAAGCTGCGCCAGGCTG

Links:

OMIM: 182309.0009; dbSNP: rs876661296

NCBI 1000 Genomes Browser:

rs876661296

Molecular consequence:

NM_001167579.2:c.272_292del - inframe_deletion - [Sequence Ontology: SO:0001822]
NM_003052.5:c.272_292del - inframe_deletion - [Sequence Ontology: SO:0001822]

Functional consequence:

no known functional consequence

Observations:

Condition(s)

Synonyms:: none provided
Identifiers:: MedGen: C3661900

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Help

Submission Accession	Submitter	Review Status (Assertion method)	Clinical Significance (Last evaluated)	Origin	Method	Citations
SCV001097443	Invitae	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015))	Benign (Jan 31, 2024)	germline	clinical testing	PubMed (1) [See all records that cite this PMID]
SCV001908150	GeneDx	criteria provided, single submitter (GeneDx Variant Classification Process June 2021)	Benign (Feb 1, 2019)	germline	clinical testing	Citation Link,
SCV004011644	CeGaT Center for Human Genetics Tuebingen	criteria provided, single submitter (CeGaT Center For Human Genetics Tuebingen Variant Classification Criteria Version 2)	Benign (Mar 1, 2024)	germline	clinical testing	Citation Link,
SCV004227159	Mayo Clinic Laboratories, Mayo Clinic	criteria provided, single submitter (ACMG Guidelines, 2015)	Uncertain significance (Jan 11, 2023)	germline	clinical testing	PubMed (12) [See all records that cite these PMIDs] 16688119, 21597970, 25296721, 26047794, 29924459, 29959532, 31672324, 33099630, 33226606, 33536578, 34805638, 25741868

Help

Summary from all submissions

Ethnicity	Origin	Affected	Individuals	Families	Chromosomes tested	Number Tested	Family history	Method
not provided	germline	yes	11	not provided	not provided	not provided	not provided	clinical testing
not provided	germline	unknown	22	not provided	not provided	not provided	not provided	clinical testing

Citations

PubMed

Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria.

Nykamp K, Anderson M, Powers M, Garcia J, Herrera B, Ho YY, Kobayashi Y, Patil N, Thusberg J, Westbrook M; Invitae Clinical Genomics Group., Topper S.

Genet Med. 2017 Oct;19(10):1105-1117. doi: 10.1038/gim.2017.37. Epub 2017 May 11. Erratum in: Genet Med. 2020 Jan;22(1):240. doi: 10.1038/s41436-019-0624-9.

PubMed [citation]

PMID:: 28492532
PMCID:: PMC5632818

NPT2a gene variation in calcium nephrolithiasis with renal phosphate leak.

Lapointe JY, Tessier J, Paquette Y, Wallendorff B, Coady MJ, Pichette V, Bonnardeaux A.

Kidney Int. 2006 Jun;69(12):2261-7. Epub 2006 May 10.

PubMed [citation]

PMID:: 16688119

See all PubMed Citations (13)

Details of each submission

From Invitae, SCV001097443.6

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (1)

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From GeneDx, SCV001908150.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	not provided

Description

This variant is associated with the following publications: (PMID: 26047794, 29959532, 25296721, 16688119, 27378183, 28470390)

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	yes	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From CeGaT Center for Human Genetics Tuebingen, SCV004011644.7

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	11	not provided	not provided	clinical testing	not provided

Description

SLC34A1: BS1, BS2

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	yes	not provided	not provided	not provided		11	not provided	not provided	not provided

From Mayo Clinic Laboratories, Mayo Clinic, SCV004227159.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	22	not provided	not provided	clinical testing	PubMed (12)

Description

BS2, PM3, PM4, PS3_supporting, PS4_moderate

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		22	not provided	not provided	not provided

Last Updated: May 12, 2024

ClinVar

Relating variation to medicine