U.S. flag

An official website of the United States government

NM_015570.4(AUTS2):c.1603_1626del (p.531HQHT[1]) AND Inborn genetic diseases

Germline classification:
Uncertain significance (1 submission)
Last evaluated:
Aug 4, 2020
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV001266310.4

Allele description [Variation Report for NM_015570.4(AUTS2):c.1603_1626del (p.531HQHT[1])]

NM_015570.4(AUTS2):c.1603_1626del (p.531HQHT[1])

Gene:
AUTS2:activator of transcription and developmental regulator AUTS2 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
7q11.22
Genomic location:
Preferred name:
NM_015570.4(AUTS2):c.1603_1626del (p.531HQHT[1])
HGVS:
  • NC_000007.14:g.70766248_70766271del
  • NG_034133.1:g.1172330_1172353del
  • NM_001127231.3:c.1603_1626del
  • NM_015570.2:c.1603_1626del
  • NM_015570.4:c.1603_1626delMANE SELECT
  • NP_001120703.1:p.531HQHT[1]
  • NP_056385.1:p.531HQHT[1]
  • NC_000007.13:g.70231221_70231244del
  • NC_000007.13:g.70231234_70231257del
  • NM_015570.2:c.1603_1626del
  • NM_015570.2:c.1603_1626del24
  • NM_015570.2:c.1603_1626del24
  • NM_015570.2:c.1603_1626delCACCAGCACACGCACCAGCACACC
  • NM_015570.3:c.1603_1626del
  • NM_015570.3:c.1603_1626del24
  • NM_015570.3:c.1603_1626delCACCAGCACACGCACCAGCACACC
  • NM_015570.4:c.1603_1626del
Links:
dbSNP: rs1789934246
NCBI 1000 Genomes Browser:
rs1789934246
Molecular consequence:
  • NM_001127231.3:c.1603_1626del - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_015570.4:c.1603_1626del - inframe_deletion - [Sequence Ontology: SO:0001822]

Condition(s)

Name:
Inborn genetic diseases
Identifiers:
MeSH: D030342; MedGen: C0950123

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Help
Submission AccessionSubmitterReview Status
(Assertion method)		Clinical Significance
(Last evaluated)		OriginMethodCitations
SCV001444483Ambry Genetics
criteria provided, single submitter

(Ambry Variant Classification Scheme 2023)		Uncertain significance
(Aug 4, 2020) 		germlineclinical testing

Citation Link

Help

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From Ambry Genetics, SCV001444483.4

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

The alteration results in an in-frame deletion:_x000D_ _x000D_ The c.1603_1626del24 (p.H535_T542del) alteration is located in coding exon 9 of the AUTS2 gene. This alteration results from an in-frame deletion of 24 nucleotides at positions c.1603 to c.1626, resulting in the deletion of 8 amino acids at codons 535 to 542. The alteration is not observed in population databases:_x000D_ _x000D_ Based on data from the Genome Aggregation Database (gnomAD), the AUTS2 c.1603_1626del24 alteration was not observed, with coverage at this position The alteration is predicted deleterious by in silico models:_x000D_ _x000D_ The p.H535_T542del alteration is predicted to be deleterious with a score of -42.658 by PROVEAN in silico analysis. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Oct 13, 2024