U.S. flag

An official website of the United States government

NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs) AND multiple conditions

Germline classification:
Pathogenic (2 submissions)
Last evaluated:
Jul 21, 2022
Review status:
2 stars out of maximum of 4 stars
criteria provided, multiple submitters, no conflicts
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV002504853.3

Allele description [Variation Report for NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs)]

NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs)

Genes:
ADAMTSL4:ADAMTS like 4 [Gene - OMIM - HGNC]
ADAMTSL4-AS2:ADAMTSL4 antisense RNA 2 [Gene - HGNC]
Variant type:
Deletion
Cytogenetic location:
1q21.2
Genomic location:
Preferred name:
NM_019032.6(ADAMTSL4):c.767_786del (p.Gln256fs)
HGVS:
  • NC_000001.11:g.150553758_150553777del
  • NG_012172.1:g.9337_9356del
  • NM_001288607.2:c.767_786del
  • NM_001288608.2:c.767_786del
  • NM_001378596.1:c.767_786del
  • NM_019032.6:c.767_786delMANE SELECT
  • NM_025008.5:c.767_786del
  • NP_001275536.1:p.Gln256fs
  • NP_001275537.1:p.Gln256fs
  • NP_001365525.1:p.Gln256fs
  • NP_061905.2:p.Gln256fs
  • NP_079284.2:p.Gln256fs
  • NC_000001.10:g.150526226_150526245del
  • NC_000001.10:g.150526234_150526253del
  • NC_000001.11:g.150553750_150553769delCAGAGCCCAGGCCTCTGGCA
  • NM_019032.4:c.767_786del
  • NM_019032.4:c.767_786delAGGCCTCTGGCACAGAGCCC
  • NM_019032.5:c.767_786delAGGCCTCTGGCACAGAGCCC
  • p.Gln256ProfsX38
Protein change:
Q256fs
Links:
OMIM: 610113.0003; dbSNP: rs199473693
NCBI 1000 Genomes Browser:
rs199473693

Condition(s)

Name:
Ectopia lentis et pupillae
Synonyms:
ECTOPIA LENTIS WITH ECTOPIA OF PUPIL
Identifiers:
MONDO: MONDO:0009153; MedGen: C1644196; Orphanet: 1885; OMIM: 225200
Name:
Ectopia lentis 2, isolated, autosomal recessive (ECTOL2)
Synonyms:
Ectopia lentis, isolated autosomal recessive
Identifiers:
MONDO: MONDO:0009152; MedGen: C3541474; Orphanet: 1885; OMIM: 225100

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV002811537Fulgent Genetics, Fulgent Genetics
criteria provided, single submitter

(ACMG Guidelines, 2015)
Pathogenic
(Sep 29, 2021)
unknownclinical testing

PubMed (1)
[See all records that cite this PMID]

SCV003924200Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago
criteria provided, single submitter

(ACMG Guidelines, 2015)
Pathogenic
(Jul 21, 2022)
germlineclinical testing

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing
not providedunknownunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology.

Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, Voelkerding K, Rehm HL; ACMG Laboratory Quality Assurance Committee..

Genet Med. 2015 May;17(5):405-24. doi: 10.1038/gim.2015.30. Epub 2015 Mar 5.

PubMed [citation]
PMID:
25741868
PMCID:
PMC4544753

Details of each submission

From Fulgent Genetics, Fulgent Genetics, SCV002811537.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1unknownunknownnot providednot providednot providednot providednot providednot providednot provided

From Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago, SCV003924200.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)

Description

This variant has been reported in the literature in the homozygous and compound heterozygous states in numerous individuals with ectopia lentis, segregating with disease in at least 6 affected family members (Selected publications: Aragon-Martin 2010 PMID: 20564469; Christensen 2010 PMID: 20702823; Neuhann 2011 PMID: 21051722; Chandra 2012 PMID: 22736615). This variant is present in 0.2% (307/128702) of European alleles in the Genome Aggregation Database (https://gnomad.broadinstitute.org/variant/1-150526225-CCAGAGCCCAGGCCTCTGGCA-C?dataset=gnomad_r2_1). Of note, this variant has been described as or suggested to be a founder mutation in multiple European populations (Christensen 2010 PMID: 20702823; Neuhann 2011 PMID: 21051722; Overwater 2017 PMID: 28642162). This variant is present in ClinVar, with several laboratories classifying it as pathogenic (Variation ID: 39555). Evolutionary conservation and computational predictive tools for this variant are limited or unavailable. This variant creates a premature stop codon 38 amino acids downstream from this location which results in an absent or abnormal protein; loss of function variants are a known mechanism of disease for this gene (Rødahl 2020 PMID: 22338190). In summary, this variant is classified as pathogenic.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: May 12, 2024