ClinVar Genomic variation as it relates to human health
NM_001370259.2(MEN1):c.1375_1391dup (p.Ala467fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_001370259.2(MEN1):c.1375_1391dup (p.Ala467fs)
Variation ID: 1070954 Accession: VCV001070954.11
- Type and length
-
Duplication, 17 bp
- Location
-
Cytogenetic: 11q13.1 11: 64804775-64804776 (GRCh38) [ NCBI UCSC ] 11: 64572247-64572248 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline May 10, 2021 Feb 28, 2024 Jun 5, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_001370259.2:c.1375_1391dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001357188.2:p.Ala467fs frameshift NM_000244.4:c.1390_1406dup NP_000235.3:p.Ala472fs frameshift NM_001370251.2:c.1501_1517dup NP_001357180.2:p.Ala509fs frameshift NM_001370260.2:c.1375_1391dup NP_001357189.2:p.Ala467fs frameshift NM_001370261.2:c.1375_1391dup NP_001357190.2:p.Ala467fs frameshift NM_001370262.2:c.1270_1286dup NP_001357191.2:p.Ala432fs frameshift NM_001370263.2:c.1270_1286dup NP_001357192.2:p.Ala432fs frameshift NM_130799.2:c.1375_1391dupAGCCGAGAGGCCGAGGC NM_130799.3:c.1375_1391dup NP_570711.2:p.Ala467fs frameshift NM_130800.3:c.1390_1406dup NP_570712.2:p.Ala472fs frameshift NM_130801.3:c.1390_1406dup NP_570713.2:p.Ala472fs frameshift NM_130802.3:c.1390_1406dup NP_570714.2:p.Ala472fs frameshift NM_130803.3:c.1390_1406dup NP_570715.2:p.Ala472fs frameshift NM_130804.3:c.1390_1406dup NP_570716.2:p.Ala472fs frameshift NC_000011.10:g.64804776_64804792dup NC_000011.9:g.64572248_64572264dup NG_008929.1:g.11503_11519dup NG_033040.1:g.3450_3466dup LRG_509:g.11503_11519dup LRG_509t2:c.1375_1391dup - Protein change
- A432fs, A467fs, A472fs, A509fs
- Other names
- -
- Canonical SPDI
- NC_000011.10:64804775:GCCTCGGCCTCTCGGCT:GCCTCGGCCTCTCGGCTGCCTCGGCCTCTCGGCT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MEN1 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
2415 | 2434 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Jun 5, 2023 | RCV001383288.15 | |
Pathogenic (1) |
criteria provided, single submitter
|
May 20, 2022 | RCV002246367.9 | |
Pathogenic (1) |
criteria provided, single submitter
|
Oct 29, 2018 | RCV002384547.8 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Oct 29, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002696370.1
First in ClinVar: Nov 29, 2022 Last updated: Nov 29, 2022 |
Comment:
The c.1375_1391dup17 pathogenic mutation, located in coding exon 9 of the MEN1 gene, results from a duplication of AGCCGAGAGGCCGAGGC at nucleotide position 1375, causing a … (more)
The c.1375_1391dup17 pathogenic mutation, located in coding exon 9 of the MEN1 gene, results from a duplication of AGCCGAGAGGCCGAGGC at nucleotide position 1375, causing a translational frameshift with a predicted alternate stop codon (p.A467Rfs*98). This alteration is expected to result in loss of function by premature protein truncation. As such, this alteration is interpreted as a disease-causing mutation. (less)
Number of individuals with the variant: 1
|
|
Pathogenic
(May 20, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV002520145.2
First in ClinVar: May 28, 2022 Last updated: Mar 04, 2023 |
Comment:
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of … (more)
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 9465067) (less)
|
|
Pathogenic
(Jun 05, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Multiple endocrine neoplasia, type 1
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV004021272.1
First in ClinVar: Jul 29, 2023 Last updated: Jul 29, 2023 |
Comment:
Variant summary: MEN1 c.1375_1391dup17 (p.Ala467ArgfsX98) results in a premature termination codon in the last exon so not expected to result in nonsense mediated decay, but … (more)
Variant summary: MEN1 c.1375_1391dup17 (p.Ala467ArgfsX98) results in a premature termination codon in the last exon so not expected to result in nonsense mediated decay, but predicted to cause a truncation of the encoded protein, which is a commonly known mechanism for disease. Variants downstream of this position have been classified as pathogenic by our laboratory. The variant was absent in 225902 control chromosomes. To our knowledge, no occurrence of c.1375_1391dup17 in individuals affected with Multiple Endocrine Neoplasia Type 1 and no experimental evidence demonstrating its impact on protein function have been reported. Three clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 and all laboratories classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. (less)
|
|
Pathogenic
(Aug 24, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Multiple endocrine neoplasia, type 1
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV001582377.4
First in ClinVar: May 10, 2021 Last updated: Feb 28, 2024 |
Comment:
This variant has not been reported in the literature in individuals with MEN1-related conditions. For these reasons, this variant has been classified as Pathogenic. This … (more)
This variant has not been reported in the literature in individuals with MEN1-related conditions. For these reasons, this variant has been classified as Pathogenic. This variant disrupts the C-terminus of the MEN1 protein. Other variant(s) that disrupt this region (p.Thr580Argfs*8) have been determined to be pathogenic (PMID: 15331604, 16449969, Invitae). This suggests that variants that disrupt this region of the protein are likely to be causative of disease. This variant is not present in population databases (ExAC no frequency). This sequence change results in a premature translational stop signal in the MEN1 gene (p.Ala467Argfs*98). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 144 amino acids of the MEN1 protein. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpText-mined citations for rs2136092832 ...
HelpRecord last updated Mar 23, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.