ClinVar Genomic variation as it relates to human health
NM_000117.3(EMD):c.-161CAACGATTCGGCTGTGACGCGA[1]
Germline
Classification
(3)
Likely benign
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation | Variation Viewer | Related variants | ||
---|---|---|---|---|---|---|
HI score | TS score | Within gene | All | |||
EMD | - | - |
GRCh38 GRCh37 |
536 | 796 |
Conditions - Germline
Condition | Classification
(# of submissions) |
Review status | Last evaluated | Variation/condition record |
---|---|---|---|---|
Likely benign (1) |
|
Apr 14, 2020 | RCV001586704.4 | |
Likely benign (1) |
|
Nov 17, 2022 | RCV002579450.3 | |
EMD-related disorder
|
Likely benign (1) |
|
Jun 26, 2023 | RCV003966234.1 |
Citations for germline classification of this variant
HelpText-mined citations for rs1463296648 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated May 12, 2024