ClinVar Genomic variation as it relates to human health
NM_001110792.2(MECP2):c.1209_1243del (p.Pro403_Glu404insTer)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_001110792.2(MECP2):c.1209_1243del (p.Pro403_Glu404insTer)
Variation ID: 1301354 Accession: VCV001301354.2
- Type and length
-
Deletion, 35 bp
- Location
-
Cytogenetic: Xq28 X: 154030621-154030655 (GRCh38) [ NCBI UCSC ] X: 153296072-153296106 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Oct 30, 2021 Oct 28, 2023 Aug 14, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_001110792.2:c.1209_1243del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001104262.1:p.Pro403_Glu404insTer frameshift NM_004992.4:c.1173_1207del MANE Plus Clinical Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_004983.1:p.Pro391_Glu392insTer frameshift NM_001316337.2:c.894_928del NP_001303266.1:p.Pro298_Glu299insTer frameshift NM_001369391.2:c.894_928del NP_001356320.1:p.Pro298_Glu299insTer frameshift NM_001369392.2:c.894_928del NP_001356321.1:p.Pro298_Glu299insTer frameshift NM_001369393.2:c.894_928del NP_001356322.1:p.Pro298_Glu299insTer frameshift NM_001369394.2:c.894_928del NP_001356323.1:p.Pro298_Glu299insTer frameshift NM_001386137.1:c.504_538del NP_001373066.1:p.Pro168_Glu169insTer frameshift NM_001386138.1:c.504_538del NP_001373067.1:p.Pro168_Glu169insTer frameshift NM_001386139.1:c.504_538del NP_001373068.1:p.Pro168_Glu169insTer frameshift NC_000023.11:g.154030623_154030657del NC_000023.10:g.153296074_153296108del NG_007107.3:g.111449_111483del LRG_764:g.111449_111483del LRG_764t1:c.1209_1243del LRG_764p1:p.Pro403_Glu404insTer LRG_764t2:c.1173_1207del LRG_764p2:p.Pro391_Glu392insTer - Protein change
- Other names
- NM_001110792.2(MECP2):c.1209_1243del
- p.Pro403_Glu404insTer
- Canonical SPDI
- NC_000023.11:154030620:GGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGG:GG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MECP2 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
1824 | 2145 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic/Likely pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Aug 14, 2023 | RCV001733390.2 | |
Pathogenic (1) |
criteria provided, single submitter
|
Oct 6, 2021 | RCV002538717.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Likely pathogenic
(Sep 28, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Rett syndrome
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV001983590.1
First in ClinVar: Oct 30, 2021 Last updated: Oct 30, 2021 |
Comment:
Variant summary: MECP2 c.1173_1207del35 (p.Glu392X) is located in the last exon and results in a premature termination codon that is not expected to cause nonsense … (more)
Variant summary: MECP2 c.1173_1207del35 (p.Glu392X) is located in the last exon and results in a premature termination codon that is not expected to cause nonsense mediated decay (NMD), but is predicted to cause a truncation of the encoded protein. Truncations downstream of this position have been reported in affected individuals (HGMD, RettBASE database). The variant was absent in 177202 control chromosomes (gnomAD). The variant c.1173_1207del35 has been reported in the literature in at least one individual affected with Rett Syndrome (Weaving_2003, Kalman_2014). To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as likely pathogenic. (less)
|
|
Pathogenic
(Oct 06, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Inborn genetic diseases
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV003576729.1
First in ClinVar: Feb 07, 2023 Last updated: Feb 07, 2023 |
Comment:
The c.1173_1207del35 (p.E392*) alteration, located in exon 4 (coding exon 3) of the MECP2 gene, consists of a deletion of 35 nucleotides from position 1173 … (more)
The c.1173_1207del35 (p.E392*) alteration, located in exon 4 (coding exon 3) of the MECP2 gene, consists of a deletion of 35 nucleotides from position 1173 to 1207, causing a translational frameshift with a predicted alternate stop codon after amino acids. This alteration occurs at the 3' terminus of the MECP2 gene, is not expected to trigger nonsense-mediated mRNA decay, and impacts the last 19% of the protein. However, premature stop codons are typically deleterious in nature and the impacted region is critical for protein function (Ambry internal data). This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). This mutation was reported in one individual with Rett syndrome (Weaving, 2003). Based on the available evidence, this alteration is classified as pathogenic. (less)
Number of individuals with the variant: 1
|
|
Pathogenic
(Aug 14, 2023)
|
criteria provided, single submitter
Method: curation
|
Rett syndrome
(X-linked inheritance)
Affected status: unknown
Allele origin:
germline
|
Centre for Population Genomics, CPG
Accession: SCV004098750.1
First in ClinVar: Oct 28, 2023 Last updated: Oct 28, 2023 |
Comment:
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria.Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel … (more)
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria.Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 2.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). This variant is absent from gnomAD (PM2_Supporting). It has been observed in at least 2 individuals with phenotypes consistent with MECP2-related disease (PS4_Supporting, RettBase internal database, PMID: 24508304, PMID: 12655490). (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Development of a genomic DNA reference material panel for Rett syndrome (MECP2-related disorders) genetic testing. | Kalman LV | The Journal of molecular diagnostics : JMD | 2014 | PMID: 24508304 |
Effects of MECP2 mutation type, location and X-inactivation in modulating Rett syndrome phenotype. | Weaving LS | American journal of medical genetics. Part A | 2003 | PMID: 12655490 |
https://erepo.clinicalgenome.org/evrepo/ui/interpretation/2f2893f5-3311-48fe-8783-f43a281135c3 | - | - | - | - |
Text-mined citations for rs2148659508 ...
HelpRecord last updated Dec 25, 2023
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.