ClinVar Genomic variation as it relates to human health
NM_001267550.2(TTN):c.34129GTTCTACCTGAAGAAGAGGAA[1] (p.11363VLPEEEE[3])
Germline
Classification
(11)
Conflicting classifications of pathogenicity
Uncertain significance(3); Benign(5); Likely benign(3)
Uncertain significance(3); Benign(5); Likely benign(3)
criteria provided, conflicting classifications
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation | Variation Viewer | Related variants | ||
---|---|---|---|---|---|---|
HI score | TS score | Within gene | All | |||
TTN | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
11689 | 31012 |
Conditions - Germline
Condition | Classification
(# of submissions) |
Review status | Last evaluated | Variation/condition record |
---|---|---|---|---|
Conflicting interpretations of pathogenicity (3) |
|
Dec 1, 2022 | RCV000118749.26 | |
Benign (3) |
|
Dec 20, 2021 | RCV000602183.14 | |
Likely benign (1) |
|
Jan 22, 2019 | RCV000852871.9 | |
Benign (1) |
|
Jan 29, 2024 | RCV001081662.15 | |
Uncertain significance (1) |
|
Jan 30, 2019 | RCV001256704.10 | |
Uncertain significance (1) |
|
- | RCV001293148.9 | |
Likely benign (1) |
|
Nov 16, 2020 | RCV003915176.1 |
Citations for germline classification of this variant
HelpText-mined citations for rs587780487 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Apr 20, 2024