ClinVar Genomic variation as it relates to human health
NM_001110792.2(MECP2):c.1191_1236del (p.Leu398fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_001110792.2(MECP2):c.1191_1236del (p.Leu398fs)
Variation ID: 143360 Accession: VCV000143360.16
- Type and length
-
Deletion, 46 bp
- Location
-
Cytogenetic: Xq28 X: 154030628-154030673 (GRCh38) [ NCBI UCSC ] X: 153296079-153296124 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Apr 24, 2015 Apr 15, 2024 Jan 10, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_001110792.2:c.1191_1236del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001104262.1:p.Leu398fs frameshift NM_004992.4:c.1155_1200del MANE Plus Clinical Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_004983.1:p.Leu386fs frameshift NM_001316337.2:c.876_921del NP_001303266.1:p.Leu293fs frameshift NM_001369391.2:c.876_921del NP_001356320.1:p.Leu293fs frameshift NM_001369392.2:c.876_921del NP_001356321.1:p.Leu293fs frameshift NM_001369393.2:c.876_921del NP_001356322.1:p.Leu293fs frameshift NM_001369394.2:c.876_921del NP_001356323.1:p.Leu293fs frameshift NM_001386137.1:c.486_531del NP_001373066.1:p.Leu163fs frameshift NM_001386138.1:c.486_531del NP_001373067.1:p.Leu163fs frameshift NM_001386139.1:c.486_531del NP_001373068.1:p.Leu163fs frameshift NM_004992.3:c.1155_1200del NM_004992.3:c.1155_1200del46 NM_004992.3:c.1155_1200delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC frameshift NC_000023.11:g.154030634_154030679del NC_000023.10:g.153296085_153296130del NG_007107.3:g.111431_111476del LRG_764:g.111431_111476del LRG_764t1:c.1191_1236del LRG_764p1:p.Leu398fs LRG_764t2:c.1155_1200del LRG_764p2:p.Leu386fs AJ132917.1:c.1155_1200del46 - Protein change
- L293fs, L398fs, L163fs
- Other names
- NM_001110792.2(MECP2):c.1191_1236del
- p.Leu398fs
- Canonical SPDI
- NC_000023.11:154030627:GGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGG:GGTGGG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MECP2 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
1824 | 2145 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (2) |
criteria provided, single submitter
|
Jan 10, 2024 | RCV000132886.4 | |
Pathogenic/Likely pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Nov 1, 2023 | RCV000479970.6 | |
Pathogenic (1) |
criteria provided, single submitter
|
Oct 17, 2023 | RCV001387825.8 | |
Pathogenic (1) |
criteria provided, single submitter
|
Aug 23, 2023 | RCV003333027.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Mar 26, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000571773.5
First in ClinVar: Apr 27, 2017 Last updated: Apr 09, 2023 |
Comment:
Identified in two unrelated females with Rett syndrome; however, in both published cases the c.1155_1200del46 variant was likely part of a complex allele, as one … (more)
Identified in two unrelated females with Rett syndrome; however, in both published cases the c.1155_1200del46 variant was likely part of a complex allele, as one of the patients also harbored an in-frame insertion/deletion while the other had a second frameshift variant in MECP2 (Lee et al., 2001; Weaving et al., 2003); Also reported as an isolated pathogenic variant in two unrelated females in RettBASE; however, no additional information is available regarding the phenotype or family history (Christodoulou et al., 2003); Frameshift variant predicted to result in protein truncation in a gene for which loss of function is a known mechanism of disease; This variant is associated with the following publications: (PMID: 12655490, 16473305, 19914908, 12872250, 11738860) (less)
|
|
Pathogenic
(Aug 23, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Syndromic X-linked intellectual disability Lubs type
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV004041345.1
First in ClinVar: Oct 07, 2023 Last updated: Oct 07, 2023 |
|
|
Pathogenic
(Jan 10, 2024)
|
criteria provided, single submitter
Method: curation
|
Rett syndrome
(X-linked inheritance)
Affected status: unknown
Allele origin:
germline
|
Centre for Population Genomics, CPG
Accession: SCV004232269.1
First in ClinVar: Feb 28, 2024 Last updated: Feb 28, 2024 |
Comment:
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert … (more)
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). ClinVar Variation ID: 143360, PMID: 23696494, 12180070 , 16473305 This variant has been identified as a de novo occurrence in an individual with Rett syndrome without confirmation of paternity and maternity (PM6). PMID 23696494 This variant is absent from gnomAD (PM2_Supporting). (less)
|
|
Pathogenic
(Oct 17, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Severe neonatal-onset encephalopathy with microcephaly
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV001588545.5
First in ClinVar: May 10, 2021 Last updated: Feb 20, 2024 |
Comment:
This sequence change creates a premature translational stop signal (p.Leu386Alafs*8) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, … (more)
This sequence change creates a premature translational stop signal (p.Leu386Alafs*8) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 101 amino acid(s) of the MECP2 protein. This variant is present in population databases (rs267608329, gnomAD 0.004%). This premature translational stop signal has been observed in individual(s) with clinical features of Rett syndrome (PMID: 16473305, 19914908). This variant is also known as c.1152_1197del. ClinVar contains an entry for this variant (Variation ID: 143360). This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Pro389*) have been determined to be pathogenic (PMID: 17089071, 17387578, 19914908, 20151026, 21982064). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. (less)
|
|
Likely pathogenic
(Nov 01, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
CeGaT Center for Human Genetics Tuebingen
Accession: SCV004184957.3
First in ClinVar: Dec 24, 2023 Last updated: Apr 15, 2024 |
Comment:
MECP2: PVS1, PM2:Supporting
Number of individuals with the variant: 1
|
|
Pathogenic
(Jan 21, 2008)
|
no assertion criteria provided
Method: curation
|
Rett syndrome
Affected status: yes
Allele origin:
unknown
|
RettBASE
Accession: SCV000187866.2
First in ClinVar: Aug 17, 2014 Last updated: Apr 24, 2015 |
Number of individuals with the variant: 1
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - not certain
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
MECP2 mutations and clinical correlations in Greek children with Rett syndrome and associated neurodevelopmental disorders. | Psoni S | Brain & development | 2012 | PMID: 21982064 |
Updating the profile of C-terminal MECP2 deletions in Rett syndrome. | Bebbington A | Journal of medical genetics | 2010 | PMID: 19914908 |
Variable phenotypic expression of a MECP2 mutation in a family. | Augenstein K | Journal of neurodevelopmental disorders | 2009 | PMID: 20151026 |
Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms. | Zahorakova D | Journal of human genetics | 2007 | PMID: 17387578 |
MECP2 and CDKL5 gene mutation analysis in Chinese patients with Rett syndrome. | Li MR | Journal of human genetics | 2007 | PMID: 17089071 |
Spectrum and distribution of MECP2 mutations in 424 Rett syndrome patients: a molecular update. | Philippe C | European journal of medical genetics | 2006 | PMID: 16473305 |
https://erepo.clinicalgenome.org/evrepo/ui/interpretation/1800e0ff-7a07-4610-b124-08685add2d75 | - | - | - | - |
Text-mined citations for rs267608329 ...
HelpRecord last updated Apr 15, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.