ClinVar Genomic variation as it relates to human health
NM_001048174.2(MUTYH):c.1323_1332dup (p.Ala445fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_001048174.2(MUTYH):c.1323_1332dup (p.Ala445fs)
Variation ID: 1523570 Accession: VCV001523570.4
- Type and length
-
Duplication, 10 bp
- Location
-
Cytogenetic: 1p34.1 1: 45331241-45331242 (GRCh38) [ NCBI UCSC ] 1: 45796913-45796914 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Mar 28, 2022 Feb 28, 2024 May 8, 2021 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_001048174.2:c.1323_1332dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001041639.1:p.Ala445fs frameshift NM_001128425.2:c.1407_1416dup MANE Plus Clinical Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001121897.1:p.Ala473fs frameshift NM_001048171.2:c.1323_1332dup NP_001041636.2:p.Ala445fs frameshift NM_001048172.2:c.1326_1335dup NP_001041637.1:p.Ala446fs frameshift NM_001048173.2:c.1323_1332dup NP_001041638.1:p.Ala445fs frameshift NM_001293190.2:c.1368_1377dup NP_001280119.1:p.Ala460fs frameshift NM_001293191.2:c.1356_1365dup NP_001280120.1:p.Ala456fs frameshift NM_001293192.2:c.1047_1056dup NP_001280121.1:p.Ala353fs frameshift NM_001293195.2:c.1323_1332dup NP_001280124.1:p.Ala445fs frameshift NM_001293196.2:c.1047_1056dup NP_001280125.1:p.Ala353fs frameshift NM_001350650.2:c.978_987dup NP_001337579.1:p.Ala330fs frameshift NM_001350651.2:c.978_987dup NP_001337580.1:p.Ala330fs frameshift NM_012222.3:c.1398_1407dup NP_036354.1:p.Ala470fs frameshift NR_146882.2:n.1551_1560dup non-coding transcript variant NR_146883.2:n.1400_1409dup non-coding transcript variant NC_000001.11:g.45331244_45331253dup NC_000001.10:g.45796916_45796925dup NG_008189.1:g.14220_14229dup LRG_220:g.14220_14229dup - Protein change
- A456fs, A470fs, A353fs, A445fs, A446fs, A460fs, A330fs, A473fs
- Other names
- -
- Canonical SPDI
- NC_000001.11:45331241:ACCTGGTGGTAC:ACCTGGTGGTACCTGGTGGTAC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MUTYH | - | - |
GRCh38 GRCh37 |
2566 | 2714 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Likely pathogenic (1) |
criteria provided, single submitter
|
May 8, 2021 | RCV002048940.4 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Likely pathogenic
(May 08, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Familial adenomatous polyposis 2
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV002311731.2
First in ClinVar: Mar 28, 2022 Last updated: Feb 28, 2024 |
Comment:
In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has … (more)
In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant disrupts the conserved PCNA binding motif of the MUTYH protein (Gln526-Phe533, also known as Gln512-Phe519 in the literature because of transcript nomenclature differences), which has been shown to be critical for MUTYH-PCNA binding (PMID: 11092888, 26377631). Experimental studies have shown that MUTYH and PCNA co-localize at sites of DNA replication, and that MUTYH-PCNA complexes possess adenine glycosylase activity (PMID: 11433026). In MUTYH-deficient murine cells, a mutated MUTYH protein in which the conserved PCNA binding motif was disrupted did not increase repair efficiency as compared to wild-type MUTYH (PMID: 11864576). While functional studies have not been performed to directly test the effect of this variant on MUTYH protein function, this suggests that disruption of this region of the protein is causative of disease. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with MUTYH-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Ala473Thrfs*62) in the MUTYH gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 77 amino acid(s) of the MUTYH protein. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Distinct functional consequences of MUTYH variants associated with colorectal cancer: Damaged DNA affinity, glycosylase activity and interaction with PCNA and Hus1. | Brinkmeyer MK | DNA repair | 2015 | PMID: 26377631 |
Replication-associated repair of adenine:8-oxoguanine mispairs by MYH. | Hayashi H | Current biology : CB | 2002 | PMID: 11864576 |
hMYH cell cycle-dependent expression, subcellular localization and association with replication foci: evidence suggesting replication-coupled repair of adenine:8-oxoguanine mispairs. | Boldogh I | Nucleic acids research | 2001 | PMID: 11433026 |
Human homolog of the MutY repair protein (hMYH) physically interacts with proteins involved in long patch DNA base excision repair. | Parker A | The Journal of biological chemistry | 2001 | PMID: 11092888 |
Text-mined citations for rs2149112377 ...
HelpRecord last updated Mar 05, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.