ClinVar Genomic variation as it relates to human health
NM_000368.5(TSC1):c.2276_2303del (p.Ala759fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000368.5(TSC1):c.2276_2303del (p.Ala759fs)
Variation ID: 1788856 Accession: VCV001788856.1
- Type and length
-
Deletion, 28 bp
- Location
-
Cytogenetic: 9q34.13 9: 132902693-132902720 (GRCh38) [ NCBI UCSC ] 9: 135778080-135778107 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Nov 29, 2022 Nov 29, 2022 Mar 11, 2020 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000368.5:c.2276_2303del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000359.1:p.Ala759fs frameshift NM_000368.4:c.2276_2303del28 frameshift NM_001162426.2:c.2273_2300del NP_001155898.1:p.Ala758fs frameshift NM_001162427.2:c.2123_2150del NP_001155899.1:p.Ala708fs frameshift NM_001362177.2:c.1913_1940del NP_001349106.1:p.Ala638fs frameshift NM_001406592.1:c.2275_2302del28 NP_001393521.1:p.Ala759Valfs frameshift NM_001406593.1:c.2275_2302del28 NP_001393522.1:p.Ala759Valfs frameshift NM_001406594.1:c.2275_2302del28 NP_001393523.1:p.Ala759Valfs frameshift NM_001406595.1:c.2275_2302del28 NP_001393524.1:p.Ala759Valfs frameshift NM_001406596.1:c.2275_2302del28 NP_001393525.1:p.Ala759Valfs frameshift NM_001406597.1:c.2272_2299del28 NP_001393526.1:p.Ala758Valfs frameshift NM_001406598.1:c.2272_2299del28 NP_001393527.1:p.Ala758Valfs frameshift NM_001406599.1:c.2272_2299del28 NP_001393528.1:p.Ala758Valfs frameshift NM_001406600.1:c.2272_2299del28 NP_001393529.1:p.Ala758Valfs frameshift NM_001406601.1:c.2260_2287del28 NP_001393530.1:p.Ala754Valfs frameshift NM_001406602.1:c.2260_2287del28 NP_001393531.1:p.Ala754Valfs frameshift NM_001406603.1:c.2257_2284del28 NP_001393532.1:p.Ala753Valfs frameshift NM_001406604.1:c.2257_2284del28 NP_001393533.1:p.Ala753Valfs frameshift NM_001406605.1:c.2275_2302del28 NP_001393534.1:p.Ala759Valfs frameshift NM_001406606.1:c.2275_2302del28 NP_001393535.1:p.Ala759Valfs frameshift NM_001406607.1:c.2275_2302del28 NP_001393536.1:p.Ala759Valfs frameshift NM_001406608.1:c.2272_2299del28 NP_001393537.1:p.Ala758Valfs frameshift NM_001406609.1:c.2272_2299del28 NP_001393538.1:p.Ala758Valfs frameshift NM_001406610.1:c.2122_2149del28 NP_001393539.1:p.Ala708Valfs frameshift NM_001406611.1:c.2119_2146del28 NP_001393540.1:p.Ala707Valfs frameshift NM_001406612.1:c.2119_2146del28 NP_001393541.1:p.Ala707Valfs frameshift NM_001406613.1:c.2119_2146del28 NP_001393542.1:p.Ala707Valfs frameshift NM_001406614.1:c.1912_1939del28 NP_001393543.1:p.Ala638Valfs frameshift NM_001406615.1:c.1912_1939del28 NP_001393544.1:p.Ala638Valfs frameshift NM_001406616.1:c.1912_1939del28 NP_001393545.1:p.Ala638Valfs frameshift NM_001406617.1:c.1912_1939del28 NP_001393546.1:p.Ala638Valfs frameshift NM_001406618.1:c.1912_1939del28 NP_001393547.1:p.Ala638Valfs frameshift NM_001406619.1:c.1912_1939del28 NP_001393548.1:p.Ala638Valfs frameshift NM_001406620.1:c.1909_1936del28 NP_001393549.1:p.Ala637Valfs frameshift NM_001406621.1:c.1909_1936del28 NP_001393550.1:p.Ala637Valfs frameshift NM_001406622.1:c.1909_1936del28 NP_001393551.1:p.Ala637Valfs frameshift NM_001406623.1:c.1909_1936del28 NP_001393552.1:p.Ala637Valfs frameshift NM_001406624.1:c.1912_1939del28 NP_001393553.1:p.Ala638Valfs frameshift NM_001406625.1:c.1909_1936del28 NP_001393554.1:p.Ala637Valfs frameshift NM_001406626.1:c.1324_1351del28 NP_001393555.1:p.Ala442Valfs frameshift NM_001406627.1:c.1321_1348del28 NP_001393556.1:p.Ala441Valfs frameshift NM_001406628.1:c.1321_1348del28 NP_001393557.1:p.Ala441Valfs frameshift NM_001406629.1:c.1222_1249del28 NP_001393558.1:p.Ala408Valfs frameshift NM_001406630.1:c.1222_1249del28 NP_001393559.1:p.Ala408Valfs frameshift NR_176214.1:n.2325_2352del28 NR_176215.1:n.2492_2519del28 NR_176216.1:n.2359_2386del28 NR_176217.1:n.2489_2516del28 NR_176218.1:n.2488_2515del28 NC_000009.12:g.132902694_132902721del NC_000009.11:g.135778081_135778108del NG_012386.1:g.46914_46941del LRG_486:g.46914_46941del LRG_486t1:c.2275_2302del28 LRG_486p1:p.Ala759Valfs - Protein change
- A638fs, A758fs, A708fs, A759fs
- Other names
- -
- Canonical SPDI
- NC_000009.12:132902692:CGCTGCTCCTGGAGCTGATTGTATCTAGC:C
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
TSC1 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
4614 | 4663 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Mar 11, 2020 | RCV002446004.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Mar 11, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002734056.1
First in ClinVar: Nov 29, 2022 Last updated: Nov 29, 2022 |
Comment:
The c.2276_2303del28 pathogenic mutation, located in coding exon 16 of the TSC1 gene, results from a deletion of 28 nucleotides at nucleotide positions 2276 to … (more)
The c.2276_2303del28 pathogenic mutation, located in coding exon 16 of the TSC1 gene, results from a deletion of 28 nucleotides at nucleotide positions 2276 to 2303, causing a translational frameshift with a predicted alternate stop codon (p.A759Vfs*5). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. (less)
Number of individuals with the variant: 1
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpThere are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated Dec 25, 2023
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.