ClinVar Genomic variation as it relates to human health
NM_000038.6(APC):c.233_264dup (p.Ser89delinsIleAlaValIleSerLeuGluTer)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000038.6(APC):c.233_264dup (p.Ser89delinsIleAlaValIleSerLeuGluTer)
Variation ID: 1789714 Accession: VCV001789714.1
- Type and length
-
Duplication, 32 bp
- Location
-
Cytogenetic: 5q22.2 5: 112767199-112767200 (GRCh38) [ NCBI UCSC ] 5: 112102896-112102897 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Nov 29, 2022 Nov 29, 2022 Oct 22, 2020 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000038.6:c.233_264dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000029.2:p.Ser89delinsIleAlaValIleSerLeuGluTer nonsense NM_001127510.3:c.233_264dup NP_001120982.1:p.Ser89delinsIleAlaValIleSerLeuGluTer nonsense NM_001127511.3:c.263_294dup NP_001120983.2:p.Ser99delinsIleAlaValIleSerLeuGluTer nonsense NM_001354895.2:c.233_264dup NP_001341824.1:p.Ser89delinsIleAlaValIleSerLeuGluTer nonsense NM_001354896.2:c.233_264dup NP_001341825.1:p.Ser89delinsIleAlaValIleSerLeuGluTer nonsense NM_001354897.2:c.263_294dup NP_001341826.1:p.Ser99delinsIleAlaValIleSerLeuGluTer nonsense NM_001354898.2:c.158_189dup NP_001341827.1:p.Ser64delinsIleAlaValIleSerLeuGluTer nonsense NM_001354899.2:c.233_264dup NP_001341828.1:p.Ser89delinsIleAlaValIleSerLeuGluTer nonsense NM_001354900.2:c.56_87dup NP_001341829.1:p.Ser30delinsIleAlaValIleSerLeuGluTer nonsense NM_001354901.2:c.56_87dup NP_001341830.1:p.Ser30delinsIleAlaValIleSerLeuGluTer nonsense NM_001354902.2:c.263_294dup NP_001341831.1:p.Ser99delinsIleAlaValIleSerLeuGluTer nonsense NM_001354903.2:c.233_264dup NP_001341832.1:p.Ser89delinsIleAlaValIleSerLeuGluTer nonsense NM_001354904.2:c.158_189dup NP_001341833.1:p.Ser64delinsIleAlaValIleSerLeuGluTer nonsense NM_001354905.2:c.56_87dup NP_001341834.1:p.Ser30delinsIleAlaValIleSerLeuGluTer nonsense NM_001354906.2:c.-803_-772dup 5 prime UTR NM_001407446.1:c.263_294dup NP_001394375.1:p.Ser99Ilefs frameshift NM_001407447.1:c.233_264dup NP_001394376.1:p.Ser89Ilefs frameshift NM_001407448.1:c.233_264dup NP_001394377.1:p.Ser89Ilefs frameshift NM_001407449.1:c.233_264dup NP_001394378.1:p.Ser89Ilefs frameshift NM_001407450.1:c.233_264dup NP_001394379.1:p.Ser89Ilefs frameshift NM_001407451.1:c.158_189dup NP_001394380.1:p.Ser64Ilefs frameshift NM_001407452.1:c.233_264dup NP_001394381.1:p.Ser89Ilefs frameshift NM_001407453.1:c.56_87dup NP_001394382.1:p.Ser30Ilefs frameshift NM_001407454.1:c.233_264dup NP_001394383.1:p.Ser89Ilefs frameshift NM_001407455.1:c.233_264dup NP_001394384.1:p.Ser89Ilefs frameshift NM_001407456.1:c.233_264dup NP_001394385.1:p.Ser89Ilefs frameshift NM_001407457.1:c.233_264dup NP_001394386.1:p.Ser89Ilefs frameshift NM_001407458.1:c.233_264dup NP_001394387.1:p.Ser89Ilefs frameshift NM_001407459.1:c.233_264dup NP_001394388.1:p.Ser89Ilefs frameshift NM_001407460.1:c.233_264dup NP_001394389.1:p.Ser89Ilefs frameshift NM_001407467.1:c.233_264dup NP_001394396.1:p.Ser89Ilefs frameshift NM_001407469.1:c.233_264dup NP_001394398.1:p.Ser89Ilefs frameshift NM_001407470.1:c.-803_-772dup NM_001407471.1:c.-803_-772dup NM_001407472.1:c.-803_-772dup NR_176365.1:n.403_434dup NR_176366.1:n.636_667dup NC_000005.10:g.112767201_112767232dup NC_000005.9:g.112102898_112102929dup NG_008481.4:g.79681_79712dup LRG_130:g.79681_79712dup LRG_130t1:c.233_264dup LRG_130p1:p.Ser89Ilefs LRG_130t2:c.233_264dup LRG_130p2:p.Ser89Ilefs LRG_130t3:c.233_264dup LRG_130p3:p.Ser89Ilefs - Protein change
- Other names
- -
- Canonical SPDI
- NC_000005.10:112767199:GATAGCAGTAATTTCCCTGGAGTAAAACTGCGG:GATAGCAGTAATTTCCCTGGAGTAAAACTGCGGATAGCAGTAATTTCCCTGGAGTAAAACTGCGG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
APC | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
14000 | 14134 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Oct 22, 2020 | RCV002448200.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Oct 22, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002732491.1
First in ClinVar: Nov 29, 2022 Last updated: Nov 29, 2022 |
Comment:
The c.233_264dup32 variant, located in coding exon 3 of the APC gene, results from a duplication of ATAGCAGTAATTTCCCTGGAGTAAAACTGCGG at nucleotide position 233, causing a translational … (more)
The c.233_264dup32 variant, located in coding exon 3 of the APC gene, results from a duplication of ATAGCAGTAATTTCCCTGGAGTAAAACTGCGG at nucleotide position 233, causing a translational frameshift with a predicted alternate stop codon (p.S89Ifs*8). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. (less)
Number of individuals with the variant: 1
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpThere are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated Dec 25, 2023
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.