ClinVar Genomic variation as it relates to human health
NM_000152.5(GAA):c.766_785delinsC (p.Tyr256fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000152.5(GAA):c.766_785delinsC (p.Tyr256fs)
Variation ID: 188880 Accession: VCV000188880.15
- Type and length
-
Indel, 20 bp
- Location
-
Cytogenetic: 17q25.3 17: 80107630-80107649 (GRCh38) [ NCBI UCSC ] 17: 78081429-78081448 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Mar 29, 2015 Feb 4, 2024 Oct 6, 2020 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000152.5(GAA):c.766_785delinsC MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_000152.5:c.766_785delinsC MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000143.2:p.Tyr256fs frameshift NM_000152.4:c.766_785delinsC NM_001079803.3:c.766_785delinsC NP_001073271.1:p.Tyr256fs frameshift NM_001079804.3:c.766_785delinsC NP_001073272.1:p.Tyr256fs frameshift NC_000017.11:g.80107630_80107649delinsC NC_000017.10:g.78081429_78081448delinsC NG_009822.1:g.11075_11094delinsC LRG_673:g.11075_11094delinsC LRG_673t1:c.766_785delinsC - Protein change
- Y256fs
- Other names
- -
- Canonical SPDI
- NC_000017.11:80107629:TATATCACAGGCCTCGCCGA:C
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
GAA | - | - |
GRCh38 GRCh38 GRCh37 |
2765 | 2815 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (5) |
reviewed by expert panel
|
Oct 6, 2020 | RCV000169234.11 | |
Pathogenic/Likely pathogenic (3) |
criteria provided, multiple submitters, no conflicts
|
May 19, 2022 | RCV000725968.10 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Oct 06, 2020)
|
reviewed by expert panel
Method: curation
|
Glycogen storage disease, type II
(Autosomal recessive inheritance)
Affected status: unknown
Allele origin:
germline
|
ClinGen Lysosomal Storage Disorder Variant Curation Expert Panel
Accession: SCV001443307.1
First in ClinVar: Nov 21, 2020 Last updated: Nov 21, 2020 |
Comment:
This variant, c.766_c.785delinsC (p.Tyr256ArgfsTer6), is a frameshift variant that is predicted to result in a premature termination codon, nonsense mediated decay, and lack of gene … (more)
This variant, c.766_c.785delinsC (p.Tyr256ArgfsTer6), is a frameshift variant that is predicted to result in a premature termination codon, nonsense mediated decay, and lack of gene product, meeting PVS1. This is supported by the finding that a patient who is compound heterozygous for this variant and another null variant has no GAA cross-reactive material in cultured skin fibroblasts i.e. CRIM-negative (PMIDs 22252923, 25763511). This patient and one other meet the ClinGen LSD VCEP's specifications for PP4. The first patient is compound heterozygous for the variant and c.2432delT (p.Leu811fsTer37) (PMID 25763511); the second is compound heterozygous for the variant and c.2014C>T (p.Arg672Trp) (PMID 9535769). The phase of the variants is unknown. In both cases, the in trans data will be used in the assessment of the second variant and was, therefore, not include here for PM3 in order to avoid a circular argument. Another patient has been reported to be compound heterozygous for the variant and c.-32-13T>G but was not included because the residual GAA activity was not reported (PMID 30564623). Finally, two siblings with adult onset Pompe disease have been reported to have the variant but the second variant and residual GAA activity were not provided (PMID 10206684). This variant is not in gnomAD v2.1.1, meeting PM2. There is a ClinVar entry for this variant (Variation ID: 188880, two star review status) with two submitters classifying the variant as pathogenic and one as likely pathogenic. In summary, this variant meets the criteria to be classified as pathogenic for Pompe disease. GAA-specific ACMG/AMP criteria applied, as specified by the ClinGen LSD VCEP: PVS1, PM2, PP4. (less)
|
|
Pathogenic
(Mar 25, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Eurofins Ntd Llc (ga)
Accession: SCV000340911.4
First in ClinVar: Dec 06, 2016 Last updated: Dec 15, 2018 |
Number of individuals with the variant: 2
Sex: mixed
|
|
Pathogenic
(Aug 08, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Glycogen storage disease, type II
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV002571856.1
First in ClinVar: Sep 17, 2022 Last updated: Sep 17, 2022 |
Comment:
Variant summary: GAA c.766_785delinsC (p.Tyr256ArgfsX6) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein … (more)
Variant summary: GAA c.766_785delinsC (p.Tyr256ArgfsX6) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant was absent in 251112 control chromosomes. c.766_785delinsC has been reported in the literature in individuals affected with Glycogen Storage Disease, Type 2 (Pompe Disease; eg. Beesley_1998, Huie_1998, Bali_2012). These data indicate that the variant is likely to be associated with disease. Five clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as pathogenic/likely pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. (less)
|
|
Likely pathogenic
(Aug 18, 2014)
|
criteria provided, single submitter
Method: literature only
|
Glycogen storage disease, type II
(Autosomal recessive inheritance)
Affected status: unknown
Allele origin:
unknown
|
Counsyl
Accession: SCV000220504.2
First in ClinVar: Mar 29, 2015 Last updated: Dec 24, 2022 |
|
|
Pathogenic
(Sep 12, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Glycogen storage disease, type II
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV004195487.1
First in ClinVar: Dec 30, 2023 Last updated: Dec 30, 2023 |
|
|
Pathogenic
(May 19, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Revvity Omics, Revvity
Accession: SCV002021189.3
First in ClinVar: Nov 29, 2021 Last updated: Feb 04, 2024 |
|
|
Pathogenic
(Dec 17, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Glycogen storage disease, type II
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV000937866.1
First in ClinVar: Aug 14, 2019 Last updated: Aug 14, 2019 |
Comment:
This sequence change creates a premature translational stop signal (p.Thr258Alafs*67) in the GAA gene. It is expected to result in an absent or disrupted protein … (more)
This sequence change creates a premature translational stop signal (p.Thr258Alafs*67) in the GAA gene. It is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has been observed in several individuals affected with Pompe disease (PMID: 22252923, 10206684). This variant is also known as Δ20nt766 in the literature. ClinVar contains an entry for this variant (Variation ID: 188880). Loss-of-function variants in GAA are known to be pathogenic (PMID: 18425781, 22252923). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
Likely pathogenic
(Feb 11, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Not provided
Affected status: yes
Allele origin:
germline
|
AiLife Diagnostics, AiLife Diagnostics
Accession: SCV002503172.1
First in ClinVar: Apr 23, 2022 Last updated: Apr 23, 2022 |
Number of individuals with the variant: 3
Secondary finding: no
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Predicting cross-reactive immunological material (CRIM) status in Pompe disease using GAA mutations: lessons learned from 10 years of clinical laboratory testing experience. | Bali DS | American journal of medical genetics. Part C, Seminars in medical genetics | 2012 | PMID: 22252923 |
The identification of five novel mutations in the lysosomal acid a-(1-4) glucosidase gene from patients with glycogen storage disease type II. Mutations in brief no. 134. Online. | Beesley CE | Human mutation | 1998 | PMID: 10206684 |
Glycogen storage disease type II: identification of four novel missense mutations (D645N, G648S, R672W, R672Q) and two insertions/deletions in the acid alpha-glucosidase locus of patients of differing phenotype. | Huie ML | Biochemical and biophysical research communications | 1998 | PMID: 9535769 |
http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=GAA | - | - | - | - |
https://erepo.clinicalgenome.org/evrepo/ui/interpretation/61f9f60d-aabd-4045-9a71-ca42e6a884e6 | - | - | - | - |
Text-mined citations for rs786204532 ...
HelpRecord last updated Mar 17, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.