ClinVar Genomic variation as it relates to human health
NM_001370259.2(MEN1):c.1642_1673delinsCC (p.Gly548_Met558delinsPro)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_001370259.2(MEN1):c.1642_1673delinsCC (p.Gly548_Met558delinsPro)
Variation ID: 2080505 Accession: VCV002080505.2
- Type and length
-
Indel, 32 bp
- Location
-
Cytogenetic: 11q13.1 11: 64804494-64804525 (GRCh38) [ NCBI UCSC ] 11: 64571966-64571997 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Feb 8, 2023 Feb 20, 2024 Jan 11, 2022 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_001370259.2:c.1642_1673delinsCC MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001357188.2:p.Gly548_Met558delinsPro inframe indel NM_000244.4:c.1657_1688delinsCC NP_000235.3:p.Gly553_Met563delinsPro inframe indel NM_001370251.2:c.1768_1799delinsCC NP_001357180.2:p.Gly590_Met600delinsPro inframe indel NM_001370260.2:c.1642_1673delinsCC NP_001357189.2:p.Gly548_Met558delinsPro inframe indel NM_001370261.2:c.1642_1673delinsCC NP_001357190.2:p.Gly548_Met558delinsPro inframe indel NM_001370262.2:c.1537_1568delinsCC NP_001357191.2:p.Gly513_Met523delinsPro inframe indel NM_001370263.2:c.1537_1568delinsCC NP_001357192.2:p.Gly513_Met523delinsPro inframe indel NM_001407142.1:c.1768_1799del32insCC NP_001394071.1:p.Gly590_Met600delinsPro inframe indel NM_001407143.1:c.1768_1799del32insCC NP_001394072.1:p.Gly590_Met600delinsPro inframe indel NM_001407144.1:c.1768_1799del32insCC NP_001394073.1:p.Gly590_Met600delinsPro inframe indel NM_001407145.1:c.1657_1688del32insCC NP_001394074.1:p.Gly553_Met563delinsPro inframe indel NM_001407146.1:c.1642_1673del32insCC NP_001394075.1:p.Gly548_Met558delinsPro inframe indel NM_001407147.1:c.1642_1673del32insCC NP_001394076.1:p.Gly548_Met558delinsPro inframe indel NM_001407148.1:c.1537_1568del32insCC NP_001394077.1:p.Gly513_Met523delinsPro inframe indel NM_001407149.1:c.1537_1568del32insCC NP_001394078.1:p.Gly513_Met523delinsPro inframe indel NM_001407150.1:c.1783_1814del32insCC NP_001394079.1:p.Gly595_Met605delinsPro inframe indel NM_001407151.1:c.1663_1694del32insCC NP_001394080.1:p.Gly555_Met565delinsPro inframe indel NM_001407152.1:c.1477_1508del32insCC NP_001394081.1:p.Gly493_Met503delinsPro inframe indel NM_130799.3:c.1642_1673delinsCC NP_570711.2:p.Gly548_Met558delinsPro inframe indel NM_130800.3:c.1657_1688delinsCC NP_570712.2:p.Gly553_Met563delinsPro inframe indel NM_130801.3:c.1657_1688delinsCC NP_570713.2:p.Gly553_Met563delinsPro inframe indel NM_130802.3:c.1657_1688delinsCC NP_570714.2:p.Gly553_Met563delinsPro inframe indel NM_130803.3:c.1657_1688delinsCC NP_570715.2:p.Gly553_Met563delinsPro inframe indel NM_130804.3:c.1657_1688delinsCC NP_570716.2:p.Gly553_Met563delinsPro inframe indel NR_176284.1:n.1840_1871del32insCC NR_176285.1:n.1852_1883del32insCC NR_176286.1:n.1855_1886del32insCC NR_176287.1:n.2113_2144del32insCC NC_000011.10:g.64804494_64804525delinsGG NC_000011.9:g.64571966_64571997delinsGG NG_008929.1:g.11770_11801delinsCC NG_033040.1:g.3717_3748delinsCC NG_033040.2:g.3689_3720delinsCC LRG_509:g.11770_11801delinsCC LRG_509t1:c.1657_1688del32insCC LRG_509p1:p.Gly553_Met563delinsPro LRG_509t2:c.1642_1673del32insCC LRG_509p2:p.Gly548_Met558delinsPro - Protein change
- Other names
- -
- Canonical SPDI
- NC_000011.10:64804493:ATCTTCTCACTCTGGAAAGTGAGCACTGGACC:GG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MEN1 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
2443 | 2460 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Jan 11, 2022 | RCV003001978.2 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Jan 11, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Multiple endocrine neoplasia, type 1
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV003294256.2
First in ClinVar: Feb 07, 2023 Last updated: Feb 20, 2024 |
Comment:
This variant, c.1642_1673delinsCC, is a complex sequence change that results in the deletion of 11 and insertion of 1 amino acid(s) in the MEN1 protein … (more)
This variant, c.1642_1673delinsCC, is a complex sequence change that results in the deletion of 11 and insertion of 1 amino acid(s) in the MEN1 protein (p.Gly548_Met558delinsPro). This variant is not present in population databases (gnomAD no frequency). For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the MEN1 protein in which other variant(s) (p.Ser555Asn) have been determined to be pathogenic (PMID: 9683585, 15254225). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. This variant has not been reported in the literature in individuals affected with MEN1-related conditions. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Menin missense mutants associated with multiple endocrine neoplasia type 1 are rapidly degraded via the ubiquitin-proteasome pathway. | Yaguchi H | Molecular and cellular biology | 2004 | PMID: 15254225 |
Germ-line mutation analysis in patients with multiple endocrine neoplasia type 1 and related disorders. | Giraud S | American journal of human genetics | 1998 | PMID: 9683585 |
Text-mined citations for this variant ...
HelpRecord last updated Feb 20, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.