ClinVar Genomic variation as it relates to human health
NM_004937.3(CTNS):c.198_218del (p.Ile67_Pro73del)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_004937.3(CTNS):c.198_218del (p.Ile67_Pro73del)
Variation ID: 21438 Accession: VCV000021438.21
- Type and length
-
Deletion, 21 bp
- Location
-
Cytogenetic: 17p13.2 17: 3648904-3648924 (GRCh38) [ NCBI UCSC ] 17: 3552198-3552218 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline May 3, 2013 Feb 28, 2024 Jan 4, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_004937.3:c.198_218del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_004928.2:p.Ile67_Pro73del inframe deletion NM_001031681.2:c.198_218del21 NM_001031681.3:c.198_218del NP_001026851.2:p.Ile67_Pro73del inframe deletion NM_001374492.1:c.198_218del NP_001361421.1:p.Ile67_Pro73del inframe deletion NM_001374493.1:c.-217+1382_-217+1402del intron variant NM_001374494.1:c.-244_-224del 5 prime UTR NM_001374495.1:c.-216-6094_-216-6074del intron variant NM_001374496.1:c.-217+1382_-217+1402del intron variant NC_000017.11:g.3648904_3648924del NC_000017.10:g.3552198_3552218del NG_012489.2:g.17437_17457del - Protein change
- Other names
- -
- Canonical SPDI
- NC_000017.11:3648903:TATTACTATCCTTGAGCTCCC:
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
Trans-Omics for Precision Medicine (TOPMed) 0.00000
Exome Aggregation Consortium (ExAC) 0.00002
The Genome Aggregation Database (gnomAD), exomes 0.00002
The Genome Aggregation Database (gnomAD) 0.00002
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
CTNS | - | - |
GRCh38 GRCh37 |
501 | 904 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic/Likely pathogenic (4) |
criteria provided, multiple submitters, no conflicts
|
Oct 19, 2023 | RCV000020623.20 | |
Pathogenic (2) |
criteria provided, single submitter
|
Apr 9, 2018 | RCV000780201.11 | |
Pathogenic (1) |
criteria provided, single submitter
|
Aug 16, 2021 | RCV002051792.11 | |
Pathogenic (1) |
criteria provided, single submitter
|
Jan 4, 2024 | RCV002513139.9 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Apr 09, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Cystinosis
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000917267.1
First in ClinVar: Jun 02, 2019 Last updated: Jun 02, 2019 |
Comment:
Variant summary: CTNS c.198_218del21 (p.Ile67_Pro73del) results in an in-frame deletion that is predicted to remove ITILELP amino acids from the encoded protein. c.198_218del21 has been … (more)
Variant summary: CTNS c.198_218del21 (p.Ile67_Pro73del) results in an in-frame deletion that is predicted to remove ITILELP amino acids from the encoded protein. c.198_218del21 has been reported in the literature in multiple individuals affected with Cystinosis as both a homozygous and compound heterozygous allele. These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as pathogenic. (less)
|
|
Pathogenic
(Aug 16, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Ocular cystinosis
Nephropathic cystinosis Juvenile nephropathic cystinosis
Affected status: unknown
Allele origin:
unknown
|
Fulgent Genetics, Fulgent Genetics
Accession: SCV002811149.1
First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022 |
|
|
Pathogenic
(Oct 19, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Nephropathic cystinosis
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV004212930.1
First in ClinVar: Dec 30, 2023 Last updated: Dec 30, 2023 |
|
|
Pathogenic
(Jan 04, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Inborn genetic diseases
Ocular cystinosis Juvenile nephropathic cystinosis
Explanation for multiple conditions: Uncertain.
The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases.
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV002215691.3
First in ClinVar: Mar 28, 2022 Last updated: Feb 28, 2024 |
Comment:
This variant, c.198_218del, results in the deletion of 7 amino acid(s) of the CTNS protein (p.Ile67_Pro73del), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.198_218del, results in the deletion of 7 amino acid(s) of the CTNS protein (p.Ile67_Pro73del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs113994204, gnomAD 0.006%). This variant has been observed in individual(s) with cystinosis (PMID: 9792862, 28629674). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 21438). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects CTNS function (PMID: 15128704). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
Pathogenic
(May 28, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
Nephropathic cystinosis
Affected status: unknown
Allele origin:
unknown
|
Mendelics
Accession: SCV001140214.1
First in ClinVar: Jan 09, 2020 Last updated: Jan 09, 2020 |
|
|
Likely pathogenic
(Dec 27, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
Nephropathic cystinosis
Affected status: unknown
Allele origin:
unknown
|
Myriad Genetics, Inc.
Accession: SCV001194238.2
First in ClinVar: Apr 06, 2020 Last updated: Jul 03, 2020 |
Comment:
NM_001031681.2(CTNS):c.198_218del21(aka I67_P73del) is classified as likely pathogenic in the context of cystinosis and is associated with a less severe form of disease. Sources cited for … (more)
NM_001031681.2(CTNS):c.198_218del21(aka I67_P73del) is classified as likely pathogenic in the context of cystinosis and is associated with a less severe form of disease. Sources cited for classification include the following: PMID 18178779‚Äé, 9792862, 21305353 and 15128704. Classification of NM_001031681.2(CTNS):c.198_218del21(aka I67_P73del) is based on the following criteria: There is strong evidence of association with the variant and the relevant disease. Please note: this variant was assessed in the context of healthy population screening. (less)
|
|
Pathogenic
(Feb 11, 2021)
|
no assertion criteria provided
Method: clinical testing
|
Cystinosis
Affected status: unknown
Allele origin:
germline
|
Natera, Inc.
Accession: SCV002093225.1
First in ClinVar: Apr 23, 2022 Last updated: Apr 23, 2022 |
|
|
not provided
(-)
|
no classification provided
Method: literature only
|
Nephropathic cystinosis
Affected status: not provided
Allele origin:
unknown
|
GeneReviews
Accession: SCV000041132.3
First in ClinVar: Apr 04, 2013 Last updated: Oct 01, 2022 |
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Cystinosis distal myopathy, novel clinical, pathological and genetic features. | Cabrera-Serrano M | Neuromuscular disorders : NMD | 2017 | PMID: 28629674 |
Cystinosis. | Adam MP | - | 2017 | PMID: 20301574 |
Whole exome sequencing identifies causative mutations in the majority of consanguineous or familial cases with childhood-onset increased renal echogenicity. | Braun DA | Kidney international | 2016 | PMID: 26489029 |
Non-invasive measurements of atherosclerosis in adult cystinosis patients. | Besouw MT | Journal of inherited metabolic disease | 2011 | PMID: 21305353 |
Analysis of the CTNS gene in nephropathic cystinosis Mexican patients: report of four novel mutations and identification of a false positive 57-kb deletion genotype with LDM-2/exon 4 multiplex PCR assay. | Alcántara-Ortigoza MA | Genetic testing | 2008 | PMID: 18752449 |
Late-onset nephropathic cystinosis: clinical presentation, outcome, and genotyping. | Servais A | Clinical journal of the American Society of Nephrology : CJASN | 2008 | PMID: 18178779 |
Molecular pathogenesis of cystinosis: effect of CTNS mutations on the transport activity and subcellular localization of cystinosin. | Kalatzis V | Human molecular genetics | 2004 | PMID: 15128704 |
CTNS mutations in an American-based population of cystinosis patients. | Shotelersuk V | American journal of human genetics | 1998 | PMID: 9792862 |
Text-mined citations for rs113994204 ...
HelpRecord last updated Apr 20, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.