ClinVar Genomic variation as it relates to human health
NM_024675.4(PALB2):c.3374_3395del (p.Asp1125fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_024675.4(PALB2):c.3374_3395del (p.Asp1125fs)
Variation ID: 233686 Accession: VCV000233686.19
- Type and length
-
Deletion, 22 bp
- Location
-
Cytogenetic: 16p12.2 16: 23603625-23603646 (GRCh38) [ NCBI UCSC ] 16: 23614946-23614967 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Dec 19, 2017 Feb 28, 2024 Oct 26, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_024675.4:c.3374_3395del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_078951.2:p.Asp1125fs frameshift NM_024675.3:c.3374_3395del22 NC_000016.10:g.23603625_23603646del NC_000016.9:g.23614946_23614967del NG_007406.1:g.42712_42733del LRG_308:g.42712_42733del - Protein change
- Other names
- -
- Canonical SPDI
- NC_000016.10:23603624:AAGATTGCTGCTGCACAGTGAT:
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
PALB2 | - | - |
GRCh38 GRCh37 |
5759 | 5798 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Jul 9, 2020 | RCV000214247.9 | |
Likely pathogenic (1) |
criteria provided, single submitter
|
Feb 27, 2018 | RCV000657478.2 | |
Pathogenic (3) |
criteria provided, multiple submitters, no conflicts
|
Oct 26, 2023 | RCV001384358.9 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Likely pathogenic
(Feb 27, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000779213.2
First in ClinVar: Jul 09, 2018 Last updated: Jul 09, 2018 |
Comment:
This deletion of 22 nucleotides in PALB2 is denoted c.3374_3395del22 at the cDNA level and p.Asp1125GlyfsX31 (D1125GfsX31) at the protein level. The surrounding sequence is … (more)
This deletion of 22 nucleotides in PALB2 is denoted c.3374_3395del22 at the cDNA level and p.Asp1125GlyfsX31 (D1125GfsX31) at the protein level. The surrounding sequence is AAAG[del22]GACT. The deletion causes a frameshift which changes an Aspartic Acid to a Glycine at codon 1125, and creates a premature stop codon at position 31 of the new reading frame. Although this variant has not, to our knowledge, been reported in the literature, it is predicted to cause loss of normal protein function through protein truncation as the last 62 amino acids are lost and replaced with 30 incorrect amino acids. The disrupted region at the end of the gene is located within the region required for interaction with POLH and POLH DNA synthesis stimulation, the region of interaction with BRCA2 and RAD51, and the WD6 and WD7 repeat domains (UniProt, Oliver 2009, Buisson 2010, Buisson 2014). Based on currently available evidence, we consider this deletion to be a likely pathogenic variant. (less)
|
|
Pathogenic
(Jan 15, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Color Diagnostics, LLC DBA Color Health
Accession: SCV000910087.3
First in ClinVar: May 20, 2019 Last updated: Jan 12, 2022 |
Comment:
This variant deletes 22 nucleotides in exon 13 of the PALB2 gene, creating a frameshift and premature translation stop signal. This variant is expected to … (more)
This variant deletes 22 nucleotides in exon 13 of the PALB2 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of PALB2 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. (less)
|
|
Pathogenic
(Jul 09, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV000278112.6
First in ClinVar: May 29, 2016 Last updated: Nov 29, 2022 |
Comment:
The c.3374_3395del22 pathogenic mutation, located in coding exon 13 of the PALB2 gene, results from a deletion of 22 nucleotides at nucleotide positions 3374 to … (more)
The c.3374_3395del22 pathogenic mutation, located in coding exon 13 of the PALB2 gene, results from a deletion of 22 nucleotides at nucleotide positions 3374 to 3395, causing a translational frameshift with a predicted alternate stop codon (p.D1125Gfs*31). This stop codon occurs at the 3' terminus of PALB2, is not expected to trigger nonsense-mediated mRNA decay, and impacts only the last 32 amino acids of the protein. However, these last 32 amino acids are part of the functionally critical WD40 domain that is necessary for PALB2 function, stability, and interaction with BRCA2 (Oliver AW et al. EMBO Rep., 2009 Sep;10:990-6). Truncating mutations located downstream of this alteration have been identified in individuals with breast cancer, pancreatic cancer, and Fanconia anemia (Hofstatter EW et al. Fam. Cancer. 2011 Jun;10:225-31; Tischkowitz M et al. Hum. Mutat. 2012 Apr;33:674-80; Pritzlaff M et al. Breast Cancer Res. Treat. 2017 Feb;161:575-586; Dudley B et al. Cancer. 2018 Apr;124:1691-1700; Reid S et al. Nat. Genet. 2007 Feb;39:162-4). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. (less)
Number of individuals with the variant: 1
|
|
Pathogenic
(Sep 15, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Familial cancer of breast
Affected status: unknown
Allele origin:
unknown
|
Myriad Genetics, Inc.
Accession: SCV004186090.1
First in ClinVar: Dec 24, 2023 Last updated: Dec 24, 2023 |
Comment:
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
|
|
Pathogenic
(Nov 03, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Familial cancer of breast
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV004202705.1
First in ClinVar: Dec 30, 2023 Last updated: Dec 30, 2023 |
|
|
Pathogenic
(Oct 26, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Familial cancer of breast
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV001583817.4
First in ClinVar: May 10, 2021 Last updated: Feb 28, 2024 |
Comment:
This sequence change creates a premature translational stop signal (p.Asp1125Glyfs*31) in the PALB2 gene. While this is not anticipated to result in nonsense mediated decay, … (more)
This sequence change creates a premature translational stop signal (p.Asp1125Glyfs*31) in the PALB2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 62 amino acid(s) of the PALB2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with breast and/or ovarian cancer (PMID: 31841383). ClinVar contains an entry for this variant (Variation ID: 233686). This variant disrupts a region of the PALB2 protein in which other variant(s) (p.Tyr1183*) have been determined to be pathogenic (PMID: 17200671, 20927582, 21165770, 21365267, 26283626). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Cancer Risks Associated With Germline PALB2 Pathogenic Variants: An International Study of 524 Families. | Yang X | Journal of clinical oncology : official journal of the American Society of Clinical Oncology | 2020 | PMID: 31841383 |
Prevalence of PALB2 mutations in Australian familial breast cancer cases and controls. | Thompson ER | Breast cancer research : BCR | 2015 | PMID: 26283626 |
PALB2 mutations in familial breast and pancreatic cancer. | Hofstatter EW | Familial cancer | 2011 | PMID: 21365267 |
PALB2 mutations in German and Russian patients with bilateral breast cancer. | Bogdanova N | Breast cancer research and treatment | 2011 | PMID: 21165770 |
Mutations in BRCA2 and PALB2 in male breast cancer cases from the United States. | Ding YC | Breast cancer research and treatment | 2011 | PMID: 20927582 |
Biallelic mutations in PALB2 cause Fanconi anemia subtype FA-N and predispose to childhood cancer. | Reid S | Nature genetics | 2007 | PMID: 17200671 |
Text-mined citations for rs876660574 ...
HelpRecord last updated Mar 05, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.