ClinVar Genomic variation as it relates to human health
NM_174936.4(PCSK9):c.45GCT[8] (p.Leu23dup)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_174936.4(PCSK9):c.45GCT[8] (p.Leu23dup)
Variation ID: 235043 Accession: VCV000235043.35
- Type and length
-
Microsatellite, 3 bp
- Location
-
Cytogenetic: 1p32.3 1: 55039879-55039880 (GRCh38) [ NCBI UCSC ] 1: 55505552-55505553 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jun 3, 2016 Feb 20, 2024 Feb 1, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_174936.4:c.45GCT[8] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_777596.2:p.Leu23dup inframe insertion NM_174936.3:c.63_65dupGCT NC_000001.11:g.55039882GCT[8] NC_000001.10:g.55505555GCT[8] NG_009061.1:g.5336GCT[8] NG_009061.1:g.5354_5356dup LRG_275:g.5336GCT[8] - Protein change
- Other names
- -
- Canonical SPDI
- NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
PCSK9 | Dosage sensitivity unlikely | No evidence available |
GRCh38 GRCh37 |
1255 | 1268 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Likely benign (4) |
criteria provided, single submitter
|
- | RCV000223787.19 | |
Benign (4) |
criteria provided, multiple submitters, no conflicts
|
Jul 7, 2017 | RCV000256353.14 | |
Benign (2) |
criteria provided, multiple submitters, no conflicts
|
Feb 1, 2024 | RCV000625171.16 | |
Benign (2) |
criteria provided, single submitter
|
May 21, 2018 | RCV000776608.12 | |
Benign/Likely benign (4) |
criteria provided, multiple submitters, no conflicts
|
Nov 29, 2023 | RCV000845341.24 | |
Benign (1) |
criteria provided, single submitter
|
Dec 14, 2015 | RCV002354623.8 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Likely benign
(-)
|
criteria provided, single submitter
Method: clinical testing
|
NOT SPECIFIED
Affected status: unknown
Allele origin:
germline
|
PreventionGenetics, part of Exact Sciences
Accession: SCV000316576.1
First in ClinVar: Oct 02, 2016 Last updated: Oct 02, 2016 |
|
|
Benign
(Mar 01, 2016)
|
criteria provided, single submitter
Method: research
|
Familial hypercholesterolemia
Affected status: yes
Allele origin:
germline
|
Cardiovascular Research Group, Instituto Nacional de Saude Doutor Ricardo Jorge
Accession: SCV000323028.1
First in ClinVar: Oct 15, 2016 Last updated: Oct 15, 2016 |
Comment:
MAF = 9% in 100 subjects with average plasma cholesterol
Observation 1:
Comment on evidence:
%MAF (ExAC):13.75
Observation 2: |
|
Benign
(Apr 26, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
Hypercholesterolemia, autosomal dominant, 3
Affected status: yes
Allele origin:
germline
|
Genome Diagnostics Laboratory, University Medical Center Utrecht
Study: VKGL Data-share Consensus
Accession: SCV000743995.1 First in ClinVar: Apr 20, 2018 Last updated: Apr 20, 2018 |
|
|
Benign
(Mar 01, 2016)
|
criteria provided, single submitter
Method: research
|
Familial hypercholesterolemia
Affected status: unknown
Allele origin:
germline
|
Iberoamerican FH Network
Accession: SCV000748065.1
First in ClinVar: May 19, 2018 Last updated: May 19, 2018 |
Comment on evidence:
%MAF(ExAC):13.75
|
|
Benign
(May 21, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Familial hypercholesterolemias
Affected status: unknown
Allele origin:
germline
|
Color Diagnostics, LLC DBA Color Health
Accession: SCV000912224.1
First in ClinVar: May 20, 2019 Last updated: May 20, 2019 |
|
|
Likely benign
(-)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute
Accession: SCV000987387.1
First in ClinVar: Sep 08, 2019 Last updated: Sep 08, 2019 |
|
|
Benign
(Nov 15, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV001894657.1
First in ClinVar: Sep 19, 2021 Last updated: Sep 19, 2021 |
Comment:
This variant is associated with the following publications: (PMID: 29562810, 30782561, 26687699, 25239117, 23743349, 16619215, 23663650, 20006333)
|
|
Benign
(Dec 14, 2015)
|
criteria provided, single submitter
Method: clinical testing
|
Cardiovascular phenotype
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002655980.1
First in ClinVar: Nov 29, 2022 Last updated: Nov 29, 2022 |
Comment:
This alteration is classified as benign based on a combination of the following: population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA … (more)
This alteration is classified as benign based on a combination of the following: population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. (less)
Number of individuals with the variant: 1
|
|
Benign
(Jul 07, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Familial hypercholesterolemia
Affected status: unknown
Allele origin:
germline
|
Color Diagnostics, LLC DBA Color Health
Accession: SCV000690984.2
First in ClinVar: Feb 19, 2018 Last updated: Dec 11, 2022 |
|
|
Benign
(Jun 20, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
unknown
|
Quest Diagnostics Nichols Institute San Juan Capistrano
Accession: SCV004222383.1
First in ClinVar: Jan 06, 2024 Last updated: Jan 06, 2024 |
|
|
Benign
(Feb 01, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Hypercholesterolemia, autosomal dominant, 3
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV001725597.4
First in ClinVar: Jun 15, 2021 Last updated: Feb 14, 2024 |
|
|
Benign
(Nov 29, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
Accession: SCV002048042.6
First in ClinVar: Jan 08, 2022 Last updated: Feb 20, 2024 |
|
|
Benign
(Jan 30, 2013)
|
no assertion criteria provided
Method: clinical testing
|
not specified
Affected status: not provided
Allele origin:
germline
|
Stanford Center for Inherited Cardiovascular Disease, Stanford University
Accession: SCV000280405.1
First in ClinVar: Jun 03, 2016 Last updated: Jun 03, 2016 |
Comment:
Note this variant was found in clinical genetic testing performed by one or more labs who may also submit to ClinVar. Thus any internal case … (more)
Note this variant was found in clinical genetic testing performed by one or more labs who may also submit to ClinVar. Thus any internal case data may overlap with the internal case data of other labs. The interpretation reviewed below is that of the Stanford Center for Inherited Cardiovascular Disease. c.63_65dupGCT in PCKS9 (aka c.61_63dupCTG, c.43_44insCTG, L21dup, L10, p.L15_16insL). This is an in-frame duplication of three nucleotides which results in insertion of a leucine in a 9-leucine track. The variant has been seen in at least 8 unrelated cases of familial hypercholesterolemia however it has also been observed at appreciable frequencies in individuals from the general population with normal cholesterol. Noguchi et al (2010) reported that 8 of 55 familial hypercholesterolemia patients without LDLR variants were heterozygous for this variant. No segregation or control data was provided. In total the variant has been seen in the homozygous state in 11 of 822 individuals and in the heterozygous state in 204 of 822 individuals from published reports and publicly available population datasets. The variant is listed in dbSNP as rs35574083 without minor allele frequency data. Another dbSNP entry, rs45454392, also represents a leucine insertion in the same track of leucine repeats, denoted c.44_45insGCT (p.Leu15delinsLeuLeu). These variants are likely synonymous as it would be impossible to know exactly where the insertion occurred in the repeat track and different groups would choose to number at different points in the track, but with both insertions leading to an additional leucine. The latter dbSNP entry includes minor allele frequency data from general populations samples in the Coriell repository with 2/24 African Americans being homozygotes for the insertion and 9/24 African American and 4/23 European individuals noted as heterozygotes. Chen et al (2005) reported allele frequencies for the L9, L10, and L11 variants in the Lipoprotein Coronary Atherosclerosis Study population (LCAS). The sample consistent of 372 35-75yo individuals with LDL-C levels of 115 to 190 mg/dL despite diet and one more coronary lesions of 30-75% stenosis.. Given this selection criteria this cannot be considered a general population sample, however their LDL levels indicate they likely did not have familial hypercholesterolemia. 90/372 individuals studied were heterozygotes for the L10 variant. Yue et al (2006) reported that in a general population sample with normal cholesterol phenotypes 101/403 individuals were heterozygoes for the L10 allele and 9/403 were homozygous. Unfortunately the NHLBI Exome Sequencing Project dataset only reports single nucleotide variation so no data is provided on this variant. Yue et al (2006) found that the variant is associated with lower LDL-C in a Caucasian sample with normal cholesterol. Individuals who had one 9 repeat copy and one 10 repeat copy (i.e. heterozygotes for this variant) had LDL-C that was 10-15 mg/dL lower. They found the 10 repeat variant was an independent predictor of LDL-C. Pisciotta et al (2011) compared total cholesterol LDL-C levels in familial hypercholesterolemia patients who were heterozygous for the 10 repeat variant with those who were homozygous for the wildtype 9 repeat variant and found no differences. However, in the subgroup of individuals treated with statins, the reduction in both total cholesterol and LDL-C was greater in heterozygotes for L10 than in wildtype homozygotes. (less)
|
|
Benign
(-)
|
no assertion criteria provided
Method: research
|
Familial hypercholesterolemia
Affected status: unknown
Allele origin:
germline
|
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde, Academisch Medisch Centrum
Accession: SCV000606673.1
First in ClinVar: Sep 30, 2017 Last updated: Sep 30, 2017 |
|
|
Benign
(-)
|
no assertion criteria provided
Method: clinical testing
|
not specified
Affected status: yes
Allele origin:
germline
|
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen
Study: VKGL Data-share Consensus
Accession: SCV001740953.3 First in ClinVar: Jul 07, 2021 Last updated: Sep 08, 2021 |
|
|
Benign
(-)
|
no assertion criteria provided
Method: clinical testing
|
not specified
Affected status: yes
Allele origin:
germline
|
Clinical Genetics, Academic Medical Center
Additional submitter:
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen
Study: VKGL Data-share Consensus
Accession: SCV001926190.1 First in ClinVar: Sep 26, 2021 Last updated: Sep 26, 2021 |
|
|
Benign
(Feb 09, 2023)
|
no assertion criteria provided
Method: clinical testing
|
Familial hypercholesterolemia
Affected status: yes
Allele origin:
germline
|
Cohesion Phenomics
Accession: SCV003836771.1
First in ClinVar: Mar 11, 2023 Last updated: Mar 11, 2023 |
|
|
click to load more click to collapse |
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpThere are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for rs35574083 ...
HelpRecord last updated Apr 20, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.