ClinVar Genomic variation as it relates to human health
Help
- Interpretation:
-
Benign
- Review status:
- criteria provided, single submitter
- Submissions:
- 3
- First in ClinVar:
- Apr 4, 2013
- Most recent Submission:
- Oct 30, 2021
- Last evaluated:
- Mar 19, 2020
- Accession:
- VCV000002527.5
- Variation ID:
- 2527
- Description:
- 3bp microsatellite
Help
NM_001012267.3(CENPP):c.564+94884TCA[15]
- Allele ID
- 17566
- Variant type
- Microsatellite
- Variant length
- 3 bp
- Cytogenetic location
- 9q22.31
- Genomic location
- 9: 92474742-92474743 (GRCh38) GRCh38 UCSC
- 9: 95237024-95237025 (GRCh37) GRCh37 UCSC
- HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_001012267.3:c.564+94884TCA[15] MANE Select intron variant NM_001193335.3:c.112_(114_?)GAT[15] NP_001180264.1:p.Glu51_Glu(51_?)Aspfs frameshift NM_001286969.1:c.228+94884TCA[15] intron variant NM_017680.6:c.112_(114_?)GAT[15] NP_060150.4:p.Glu51_Glu(51_?)Aspfs frameshift NC_000009.12:g.92474745ATC[15] NC_000009.11:g.95237027ATC[15] NG_023430.2:g.12723TGA[15] - Protein change
- -
- Other names
- ASPN, 14 ASP REPEAT
- Canonical SPDI
- NC_000009.12:92474742:TCATCATCATCATCATCATCATCATCATCATCATCATCATCATC:TCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATC
- Functional consequence
- -
- Global minor allele frequency (GMAF)
- -
- Allele frequency
- -
- Links
- OMIM: 608135.0001
- dbSNP: rs3078372
- VarSome
Help
Aggregate interpretations per condition
| Interpreted condition | Interpretation | Number of submissions | Review status | Last evaluated | Variation/condition record |
|---|---|---|---|---|---|
| risk factor | 1 | no assertion criteria provided | Mar 1, 2008 | RCV000002635.4 | |
| risk factor | 1 | no assertion criteria provided | Mar 1, 2008 | RCV000002636.4 | |
| Benign | 1 | criteria provided, single submitter | Mar 19, 2020 | RCV001731274.4 |
Submitted interpretations and evidence
Help| Interpretation (Last evaluated) |
Review status (Assertion criteria) |
Condition (Inheritance) |
Submitter | More information | |
|---|---|---|---|---|---|
|
Benign
(Mar 19, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Affected status: yes
Allele origin:
germline
|
Al Jalila Children's Genomics Center, Al Jalila Childrens Speciality Hospital
Accession: SCV001984050.1
First in ClinVar: Oct 30, 2021 Last updated: Oct 30, 2021 |
|
|
|
risk factor
(Mar 01, 2008)
|
no assertion criteria provided
Method: literature only
|
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000022793.1
First in ClinVar: Apr 04, 2013 Last updated: Apr 04, 2013 |
Comment on evidence:
In 2 independent populations of individuals with knee osteoarthritis (OS3; 607850), Kizawa et al. (2005) found that an ASPN allele having 14 aspartic acid repeats … (more)
In 2 independent populations of individuals with knee osteoarthritis (OS3; 607850), Kizawa et al. (2005) found that an ASPN allele having 14 aspartic acid repeats in the N-terminal region of the protein, designated D14, was overrepresented relative to the common allele having 13 aspartic acid repeats (D13); the frequency of the D14 allele increased with disease severity. The D14 allele was also overrepresented in individuals with hip osteoarthritis. Jiang et al. (2006) genotyped the D14 polymorphism in 218 Han Chinese with radiographically confirmed symptomatic knee osteoarthritis and 454 age-matched controls and found that the D14 allele was significantly overrepresented in knee osteoarthritis patients (p = 0.0063 after Bonferroni correction; odds ratio, 2.04). D14 was more frequent in early-onset patients, and the age at onset in patients with D14 was earlier. In a Chinese cohort of 527 patients with lumbar disc degeneration (LDD; 603932) and 528 controls and a Japanese cohort of 745 patients and 608 controls, Song et al. (2008) found that the D14 allele of the ASPN gene was associated with the disorder. They found that ASPN expression in vertebral discs increased with age and degeneration. Metaanalysis showed an overall odds ratio of 1.70 (p = 0.000013) for the D14 genotype in a dominant model. In the Chinese cohort, Song et al. (2008) also found a correlation of the D14 allele with the number of degenerated discs in an individual. (less)
|
|
|
risk factor
(Mar 01, 2008)
|
no assertion criteria provided
Method: literature only
|
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000022794.1
First in ClinVar: Apr 04, 2013 Last updated: Apr 04, 2013 |
Comment on evidence:
In 2 independent populations of individuals with knee osteoarthritis (OS3; 607850), Kizawa et al. (2005) found that an ASPN allele having 14 aspartic acid repeats … (more)
In 2 independent populations of individuals with knee osteoarthritis (OS3; 607850), Kizawa et al. (2005) found that an ASPN allele having 14 aspartic acid repeats in the N-terminal region of the protein, designated D14, was overrepresented relative to the common allele having 13 aspartic acid repeats (D13); the frequency of the D14 allele increased with disease severity. The D14 allele was also overrepresented in individuals with hip osteoarthritis. Jiang et al. (2006) genotyped the D14 polymorphism in 218 Han Chinese with radiographically confirmed symptomatic knee osteoarthritis and 454 age-matched controls and found that the D14 allele was significantly overrepresented in knee osteoarthritis patients (p = 0.0063 after Bonferroni correction; odds ratio, 2.04). D14 was more frequent in early-onset patients, and the age at onset in patients with D14 was earlier. In a Chinese cohort of 527 patients with lumbar disc degeneration (LDD; 603932) and 528 controls and a Japanese cohort of 745 patients and 608 controls, Song et al. (2008) found that the D14 allele of the ASPN gene was associated with the disorder. They found that ASPN expression in vertebral discs increased with age and degeneration. Metaanalysis showed an overall odds ratio of 1.70 (p = 0.000013) for the D14 genotype in a dominant model. In the Chinese cohort, Song et al. (2008) also found a correlation of the D14 allele with the number of degenerated discs in an individual. (less)
|
Functional evidence
Help| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Association of the asporin D14 allele with lumbar-disc degeneration in Asians. | Song YQ | American journal of human genetics | 2008 | PMID: 18304494 |
| Replication of the association of the aspartic acid repeat polymorphism in the asporin gene with knee-osteoarthritis susceptibility in Han Chinese. | Jiang Q | Journal of human genetics | 2006 | PMID: 17024313 |
| An aspartic acid repeat polymorphism in asporin inhibits chondrogenesis and increases susceptibility to osteoarthritis. | Kizawa H | Nature genetics | 2005 | PMID: 15640800 |
Text-mined citations for rs3078372...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Oct 15, 2023