VCV002571196.13 - ClinVar

NM_006218.4(PIK3CA):c.1340_1366del (p.Pro447_Leu455del)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(2)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic/Likely pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_006218.4(PIK3CA):c.1340_1366del (p.Pro447_Leu455del)

Variation ID: 2571196 Accession: VCV002571196.13

Type and length

Deletion, 27 bp

Location

Cytogenetic: 3q26.32 3: 179210272-179210298 (GRCh38) [ NCBI UCSC ] 3: 178928060-178928086 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Jul 17, 2023	Oct 20, 2024	Sep 6, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_006218.4:c.1340_1366del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_006209.2:p.Pro447_Leu455del	inframe deletion
NC_000003.12:g.179210274_179210300del
NC_000003.11:g.178928062_178928088del
NG_012113.2:g.66752_66778del
LRG_310:g.66752_66778del
LRG_310t1:c.1340_1366del27	LRG_310p1:p.Pro447_Leu455del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000003.12:179210271:GCCAGTACCTCATGGATTAGAAGATTTGC:GC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
PIK3CA		No evidence available	No evidence available	GRCh38 GRCh37	1303	1337

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Pathogenic (1)	criteria provided, single submitter	May 1, 2023	RCV003312597.12
PIK3CA related overgrowth syndrome	Likely pathogenic (1)	criteria provided, single submitter	Sep 6, 2023	RCV003458258.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (Sep 06, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	PIK3CA-related overgrowth syndrome Affected status: yes Allele origin: somatic	Clinical Genomics Laboratory, Washington University in St. Louis Accession: SCV004176907.1 First in ClinVar: Dec 24, 2023 Last updated: Dec 24, 2023	Comment: The PIK3CA c.1340_1366del (p.Pro447_Leu455del) variant was identified at an allelic fraction consistent with somatic origin. This variant has been reported in two individuals affected with … (more) The PIK3CA c.1340_1366del (p.Pro447_Leu455del) variant was identified at an allelic fraction consistent with somatic origin. This variant has been reported in two individuals affected with PROS disorders (Kirstein AS et al., PMID: 31627436; Li D et al., PMID: 37264205). This variant has been reported in the ClinVar database as a pathogenic germline variant by one submitter (ClinVar ID: 2571196), and it has been reported in three cases in the cancer database COSMIC (Genomic Mutation ID: COSV56030552). The PIK3CA c.1340_1366del (p.Pro447_Leu455del) variant is absent from the general population (gnomAD v.3.1.2), indicating it is not a common variant. This variant is predicted to cause a change in the length of the protein due to an in-frame deletion of nine amino acids in a non-repeat region. This variant resides within a region, the C2 domain, amino acids 325-484, of PIK3CA that is defined as a critical functional domain (Zhao L et al., PMID: 18268322; Samuels Y et al., PMID: 15016963; Wu H et al., PMID: 19915146). In vitro functional studies show that this variant affects protein stability and hyperactivates the PI3K/AKT/TOR pathway and induces cell transformation (Croessmann S et al., PMID: 29284706). Based on an internally-developed protocol informed by the ACMG/AMP guidelines (Richards S et al., PMID: 25741868) and gene-specific practices from the ClinGen Criteria Specification Registry, the PIK3CA c.1340_1366del (p.Pro447_Leu455del) variant is classified as likely pathogenic. (less)
Pathogenic (May 01, 2023)	criteria provided, single submitter (CeGaT Center For Human Genetics Tuebingen Variant Classification Criteria Version 2) Method: clinical testing	not provided Affected status: yes Allele origin: germline	CeGaT Center for Human Genetics Tuebingen Accession: SCV004011510.12 First in ClinVar: Jul 16, 2023 Last updated: Oct 20, 2024	Number of individuals with the variant: 1

Comment:

The PIK3CA c.1340_1366del (p.Pro447_Leu455del) variant was identified at an allelic fraction consistent with somatic origin. This variant has been reported in two individuals affected with PROS disorders (Kirstein AS et al., PMID: 31627436; Li D et al., PMID: 37264205). This variant has been reported in the ClinVar database as a pathogenic germline variant by one submitter (ClinVar ID: 2571196), and it has been reported in three cases in the cancer database COSMIC (Genomic Mutation ID: COSV56030552). The PIK3CA c.1340_1366del (p.Pro447_Leu455del) variant is absent from the general population (gnomAD v.3.1.2), indicating it is not a common variant. This variant is predicted to cause a change in the length of the protein due to an in-frame deletion of nine amino acids in a non-repeat region. This variant resides within a region, the C2 domain, amino acids 325-484, of PIK3CA that is defined as a critical functional domain (Zhao L et al., PMID: 18268322; Samuels Y et al., PMID: 15016963; Wu H et al., PMID: 19915146). In vitro functional studies show that this variant affects protein stability and hyperactivates the PI3K/AKT/TOR pathway and induces cell transformation (Croessmann S et al., PMID: 29284706). Based on an internally-developed protocol informed by the ACMG/AMP guidelines (Richards S et al., PMID: 25741868) and gene-specific practices from the ClinGen Criteria Specification Registry, the PIK3CA c.1340_1366del (p.Pro447_Leu455del) variant is classified as likely pathogenic.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for this variant ...

Record last updated Oct 20, 2024

ClinVar Genomic variation as it relates to human health

NM_006218.4(PIK3CA):c.1340_1366del (p.Pro447_Leu455del)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...