ACMG criteria used to clasify this variant:PVS1, PM2_SUP
ClinVar Genomic variation as it relates to human health
NM_000179.3(MSH6):c.3955_3974dup (p.Met1326fs)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(1)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Likely pathogenic
1
criteria provided, single submitter
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000179.3(MSH6):c.3955_3974dup (p.Met1326fs)
Variation ID: 2583152 Accession: VCV002583152.1
- Type and length
-
Duplication, 20 bp
- Location
-
Cytogenetic: 2p16.3 2: 47806603-47806604 (GRCh38) [ NCBI UCSC ] 2: 48033742-48033743 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Oct 21, 2023 Oct 21, 2023 Aug 3, 2023 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000179.3:c.3955_3974dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000170.1:p.Met1326fs frameshift NM_001281492.2:c.3565_3584dup NP_001268421.1:p.Met1196fs frameshift NM_001281493.2:c.3049_3068dup NP_001268422.1:p.Met1024fs frameshift NM_001281494.2:c.3049_3068dup NP_001268423.1:p.Met1024fs frameshift NM_001406795.1:c.4051_4070dup NP_001393724.1:p.Met1358fs frameshift NM_001406796.1:c.3955_3974dup NP_001393725.1:p.Met1326fs frameshift NM_001406797.1:c.3658_3677dup NP_001393726.1:p.Met1227fs frameshift NM_001406798.1:c.3781_3800dup NP_001393727.1:p.Met1268fs frameshift NM_001406799.1:c.3430_3449dup NP_001393728.1:p.Met1151fs frameshift NM_001406800.1:c.3942_3961dup NP_001393729.1:p.Arg1321delinsLysSerLysArgIleTer nonsense NM_001406801.1:c.3658_3677dup NP_001393730.1:p.Met1227fs frameshift NM_001406802.1:c.3898-174_3898-155dup intron variant NM_001406803.1:c.3091_3110dup NP_001393732.1:p.Met1038fs frameshift NM_001406804.1:c.3877_3896dup NP_001393733.1:p.Met1300fs frameshift NM_001406805.1:c.3658_3677dup NP_001393734.1:p.Met1227fs frameshift NM_001406806.1:c.3430_3449dup NP_001393735.1:p.Met1151fs frameshift NM_001406807.1:c.3430_3449dup NP_001393736.1:p.Met1151fs frameshift NM_001406808.1:c.3955_3974dup NP_001393737.1:p.Met1326fs frameshift NM_001406809.1:c.3955_3974dup NP_001393738.1:p.Met1326fs frameshift NM_001406811.1:c.3049_3068dup NP_001393740.1:p.Met1024fs frameshift NM_001406812.1:c.3049_3068dup NP_001393741.1:p.Met1024fs frameshift NM_001406813.1:c.3961_3980dup NP_001393742.1:p.Met1328fs frameshift NM_001406814.1:c.3049_3068dup NP_001393743.1:p.Met1024fs frameshift NM_001406815.1:c.3049_3068dup NP_001393744.1:p.Met1024fs frameshift NM_001406816.1:c.3049_3068dup NP_001393745.1:p.Met1024fs frameshift NM_001406817.1:c.2389_2408dup NP_001393746.1:p.Met804fs frameshift NM_001406818.1:c.3658_3677dup NP_001393747.1:p.Met1227fs frameshift NM_001406819.1:c.3658_3677dup NP_001393748.1:p.Met1227fs frameshift NM_001406820.1:c.3658_3677dup NP_001393749.1:p.Met1227fs frameshift NM_001406821.1:c.3658_3677dup NP_001393750.1:p.Met1227fs frameshift NM_001406822.1:c.3658_3677dup NP_001393751.1:p.Met1227fs frameshift NM_001406823.1:c.3049_3068dup NP_001393752.1:p.Met1024fs frameshift NM_001406824.1:c.3658_3677dup NP_001393753.1:p.Met1227fs frameshift NM_001406825.1:c.3658_3677dup NP_001393754.1:p.Met1227fs frameshift NM_001406826.1:c.3787_3806dup NP_001393755.1:p.Met1270fs frameshift NM_001406827.1:c.3658_3677dup NP_001393756.1:p.Met1227fs frameshift NM_001406828.1:c.3658_3677dup NP_001393757.1:p.Met1227fs frameshift NM_001406829.1:c.3049_3068dup NP_001393758.1:p.Met1024fs frameshift NM_001406830.1:c.3658_3677dup NP_001393759.1:p.Met1227fs frameshift NM_001406831.1:c.736_755dup NP_001393760.1:p.Met253fs frameshift NM_001406832.1:c.802_821dup NP_001393761.1:p.Met275fs frameshift NM_001407362.1:c.1900_1919dup NP_001394291.1:p.Met641fs frameshift NR_176256.1:n.2885_2904dup non-coding transcript variant NR_176257.1:n.4216_4235dup non-coding transcript variant NR_176258.1:n.4145_4164dup non-coding transcript variant NR_176259.1:n.4044_4063dup non-coding transcript variant NR_176260.1:n.1989_2008dup NR_176261.1:n.3926_3945dup non-coding transcript variant NC_000002.12:g.47806605_47806624dup NC_000002.11:g.48033744_48033763dup NG_007111.1:g.28459_28478dup NG_008397.1:g.104053_104072dup LRG_219:g.28459_28478dup LRG_219t1:c.3955_3974dup LRG_219p1:p.Met1326Lysfs - Protein change
- M1024fs, M1038fs, M1151fs, M1196fs, M1227fs, M1268fs, M1270fs, M1300fs, M1326fs, M1328fs, M1358fs, M253fs, M275fs, M641fs, M804fs
- Other names
- -
- Canonical SPDI
- NC_000002.12:47806603:AAAAGCAAGAGAATTTGAGAA:AAAAGCAAGAGAATTTGAGAAAAAGCAAGAGAATTTGAGAA
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| MSH6 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
9161 | 9479 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Likely pathogenic (1) |
criteria provided, single submitter
|
Aug 3, 2023 | RCV003334440.1 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Likely pathogenic
(Aug 03, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Lynch syndrome 5
Affected status: yes
Allele origin:
germline
|
Human Genetics Bochum, Ruhr University Bochum
Accession: SCV004042796.1
First in ClinVar: Oct 21, 2023 Last updated: Oct 21, 2023 |
Comment:
ACMG criteria used to clasify this variant:PVS1, PM2_SUP
|
Comment:
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
ACMG criteria used to clasify this variant:PVS1, PM2_SUP
Citations for germline classification of this variant
Help| There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated Oct 08, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.