ClinVar Genomic variation as it relates to human health
NM_174936.4(PCSK9):c.45GCT[6] (p.Leu23del)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Uncertain significance(2); Benign(2); Likely benign(6)
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_174936.4(PCSK9):c.45GCT[6] (p.Leu23del)
Variation ID: 265917 Accession: VCV000265917.22
- Type and length
-
Microsatellite, 3 bp
- Location
-
Cytogenetic: 1p32.3 1: 55039880-55039882 (GRCh38) [ NCBI UCSC ] 1: 55505553-55505555 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Oct 15, 2016 Mar 16, 2024 Feb 1, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_174936.4:c.45GCT[6] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_777596.2:p.Leu23del inframe deletion NM_174936.3:c.63_65delGCT NC_000001.11:g.55039882GCT[6] NC_000001.10:g.55505555GCT[6] NG_009061.1:g.5336GCT[6] NG_009061.1:g.5354_5356del LRG_275:g.5336GCT[6] - Protein change
- L23del
- Other names
- -
- Canonical SPDI
- NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
PCSK9 | Dosage sensitivity unlikely | No evidence available |
GRCh38 GRCh37 |
1255 | 1268 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Conflicting interpretations of pathogenicity (5) |
criteria provided, conflicting classifications
|
Jan 2, 2018 | RCV000256266.16 | |
Likely benign (1) |
criteria provided, single submitter
|
Feb 1, 2024 | RCV000544697.18 | |
Benign (2) |
criteria provided, multiple submitters, no conflicts
|
Mar 11, 2020 | RCV001194056.10 | |
Likely benign (1) |
criteria provided, single submitter
|
Dec 7, 2020 | RCV001577383.11 | |
Likely benign (1) |
criteria provided, single submitter
|
Jul 12, 2018 | RCV002365273.8 | |
Likely benign (1) |
criteria provided, single submitter
|
Jun 4, 2019 | RCV003977721.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Uncertain significance
(Mar 01, 2016)
|
criteria provided, single submitter
Method: research
|
Familial hypercholesterolemia
Affected status: yes
Allele origin:
germline
|
Cardiovascular Research Group, Instituto Nacional de Saude Doutor Ricardo Jorge
Accession: SCV000323029.1
First in ClinVar: Oct 15, 2016 Last updated: Oct 15, 2016 |
Observation 1:
Comment on evidence:
%MAF (ExAC):0.2535
Observation 2: |
|
Uncertain significance
(Mar 01, 2016)
|
criteria provided, single submitter
Method: research
|
Familial hypercholesterolemia
Affected status: unknown
Allele origin:
germline
|
Laboratory of Genetics and Molecular Cardiology, University of São Paulo
Study: HipercolBrasil
Accession: SCV000588676.1 First in ClinVar: Aug 13, 2017 Last updated: Aug 13, 2017 |
Comment on evidence:
%MAF(ExAC):0.2535
|
|
Likely benign
(Jan 02, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Hypercholesterolemia, familial, 1
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
germline
|
Robarts Research Institute, Western University
Accession: SCV000782988.1
First in ClinVar: Feb 19, 2018 Last updated: Feb 19, 2018 |
|
|
Benign
(Aug 13, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV001363304.1
First in ClinVar: Jun 22, 2020 Last updated: Jun 22, 2020 |
Comment:
Variant summary: PCSK9 c.63_65delGCT (p.Leu23del) results in an in-frame deletion that is predicted to remove a Leu amino acid from the encoded protein. The variant … (more)
Variant summary: PCSK9 c.63_65delGCT (p.Leu23del) results in an in-frame deletion that is predicted to remove a Leu amino acid from the encoded protein. The variant allele was found at a frequency of 0.0007 in 161082 control chromosomes. The observed variant frequency is approximately 35-folds over the estimated maximal expected allele frequency for a pathogenic variant in PCSK9 causing Early Onset Coronary Artery Disease phenotype (2e-05), strongly suggesting that the variant is benign. Five ClinVar submissions (evaluation after 2014) cites the variant three times as likely benign and twice as uncertain significance. Based on the evidence outlined above, the variant was classified as benign. (less)
|
|
Benign
(Mar 11, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
unknown
|
Quest Diagnostics Nichols Institute San Juan Capistrano
Accession: SCV001470595.1
First in ClinVar: Jan 26, 2021 Last updated: Jan 26, 2021 |
|
|
Likely benign
(Dec 07, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV001804745.1
First in ClinVar: Aug 21, 2021 Last updated: Aug 21, 2021 |
Comment:
This variant is associated with the following publications: (PMID: 33303402, 29572815)
|
|
Likely benign
(Jul 12, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Cardiovascular phenotype
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002656673.1
First in ClinVar: Nov 29, 2022 Last updated: Nov 29, 2022 |
Comment:
This alteration is classified as likely benign based on a combination of the following: population frequency, intact protein function, lack of segregation with disease, co-occurrence, … (more)
This alteration is classified as likely benign based on a combination of the following: population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. (less)
Number of individuals with the variant: 1
|
|
Likely benign
(Jul 07, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Familial hypercholesterolemia
Affected status: unknown
Allele origin:
germline
|
Color Diagnostics, LLC DBA Color Health
Accession: SCV000690983.2
First in ClinVar: Feb 19, 2018 Last updated: Dec 11, 2022 |
|
|
Likely benign
(Feb 01, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Hypercholesterolemia, autosomal dominant, 3
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV000644872.8
First in ClinVar: Dec 26, 2017 Last updated: Feb 20, 2024 |
|
|
Likely benign
(Jun 04, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
PCSK9-related condition
Affected status: unknown
Allele origin:
germline
|
PreventionGenetics, part of Exact Sciences
Accession: SCV004793510.1
First in ClinVar: Mar 16, 2024 Last updated: Mar 16, 2024 |
Comment:
This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications).
|
|
Benign
(-)
|
no assertion criteria provided
Method: research
|
Familial hypercholesterolemia
Affected status: unknown
Allele origin:
germline
|
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde, Academisch Medisch Centrum
Accession: SCV000606672.1
First in ClinVar: Aug 13, 2017 Last updated: Aug 13, 2017 |
|
|
click to load more click to collapse |
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Single, short in-del, and copy number variations detection in monogenic dyslipidemia using a next-generation sequencing strategy. | Marmontel O | Clinical genetics | 2018 | PMID: 29572815 |
Text-mined citations for this variant ...
HelpRecord last updated Apr 20, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.