VCV002664315.1 - ClinVar

NM_001110792.2(MECP2):c.1197_1235delinsTGAG (p.Pro400fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001110792.2(MECP2):c.1197_1235delinsTGAG (p.Pro400fs)

Variation ID: 2664315 Accession: VCV002664315.1

Type and length

Indel, 39 bp

Location

Cytogenetic: Xq28 X: 154030629-154030667 (GRCh38) [ NCBI UCSC ] X: 153296080-153296118 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Dec 9, 2023	Dec 9, 2023	Nov 30, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_001110792.2:c.1197_1235delinsTGAG MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001104262.1:p.Pro400fs	frameshift
NM_004992.4:c.1161_1199delinsTGAG MANE Plus Clinical Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_004983.1:p.Pro388fs	frameshift
NM_001316337.2:c.882_920delinsTGAG	NP_001303266.1:p.Pro295fs	frameshift
NM_001369391.2:c.882_920delinsTGAG	NP_001356320.1:p.Pro295fs	frameshift
NM_001369392.2:c.882_920delinsTGAG	NP_001356321.1:p.Pro295fs	frameshift
NM_001369393.2:c.882_920delinsTGAG	NP_001356322.1:p.Pro295fs	frameshift
NM_001369394.2:c.882_920delinsTGAG	NP_001356323.1:p.Pro295fs	frameshift
NM_001386137.1:c.492_530delinsTGAG	NP_001373066.1:p.Pro165fs	frameshift
NM_001386138.1:c.492_530delinsTGAG	NP_001373067.1:p.Pro165fs	frameshift
NM_001386139.1:c.492_530delinsTGAG	NP_001373068.1:p.Pro165fs	frameshift
NC_000023.11:g.154030629_154030667delinsCTCA
NC_000023.10:g.153296080_153296118delinsCTCA
NG_007107.3:g.111437_111475delinsTGAG
LRG_764:g.111437_111475delinsTGAG
LRG_764t1:c.1197_1235delinsTGAG	LRG_764p1:p.Pro400fs
LRG_764t2:c.1161_1199delinsTGAG	LRG_764p2:p.Pro388fs

... more HGVS ... less HGVS

Protein change

P165fs, P295fs, P388fs, P400fs

Other names

NM_004992.4:c.1161_1199delinsTGAG
NM_004992.4:p.(Pro388GlufsTer5)
NP_001104262.1:p.(Pro400GlufsTer5)

Canonical SPDI

NC_000023.11:154030628:GTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGG:CTCA

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
MECP2		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh37	1896	2224

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Rett syndrome	Pathogenic (1)	criteria provided, single submitter	Nov 30, 2023	RCV003445420.2

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Nov 30, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Rett syndrome Affected status: yes Allele origin: de novo	Unidad de Genómica Garrahan, Hospital de Pediatría Garrahan Accession: SCV004174140.1 First in ClinVar: Dec 09, 2023 Last updated: Dec 09, 2023	Publications: PubMed (1) PubMed: 20301670 Comment: This sequence change in exon 3 results in a frameshift that, at the protein level, would lead to the appearance of a premature stop codon … (more) This sequence change in exon 3 results in a frameshift that, at the protein level, would lead to the appearance of a premature stop codon at position 400 (p.(Pro400GlufsTer5)). This variant is considered a null variant in a gene where loss of function is a known mechanism of disease. It has zero observations in control databases, and there are no previous reports in the literature or in databases associated with genetic diseases identifying it as either a pathogenic or benign variant to our knowledge. However, the patient's phenotype is specific to Rett syndrome, a disease with a single genetic etiology (pathogenic variants in the MECP2 gene). Considering that the parents do not carry the variant, its origin is presumed to be de novo. For these reasons, we have classified this variant as Pathogenic, according to the following ACMG criteria: PVS1, PM2, PM6 and PP4. (less) Number of individuals with the variant: 1 Age: 0-9 years Sex: female Geographic origin: Argentina

Comment:

This sequence change in exon 3 results in a frameshift that, at the protein level, would lead to the appearance of a premature stop codon at position 400 (p.(Pro400GlufsTer5)). This variant is considered a null variant in a gene where loss of function is a known mechanism of disease. It has zero observations in control databases, and there are no previous reports in the literature or in databases associated with genetic diseases identifying it as either a pathogenic or benign variant to our knowledge. However, the patient's phenotype is specific to Rett syndrome, a disease with a single genetic etiology (pathogenic variants in the MECP2 gene). Considering that the parents do not carry the variant, its origin is presumed to be de novo. For these reasons, we have classified this variant as Pathogenic, according to the following ACMG criteria: PVS1, PM2, PM6 and PP4.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
MECP2 Disorders.	Adam MP	-	2019	PMID: 20301670

Text-mined citations for this variant ...

Record last updated Jun 23, 2024

ClinVar Genomic variation as it relates to human health

NM_001110792.2(MECP2):c.1197_1235delinsTGAG (p.Pro400fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...