VCV002949805.1 - ClinVar

NM_139276.3(STAT3):c.1775AGCGGG[3] (p.Arg595_Ala596insGluArg)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Uncertain significance

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_139276.3(STAT3):c.1775AGCGGG[3] (p.Arg595_Ala596insGluArg)

Variation ID: 2949805 Accession: VCV002949805.1

Type and length

Microsatellite, 6 bp

Location

Cytogenetic: 17q21.2 17: 42323105-42323106 (GRCh38) [ NCBI UCSC ] 17: 40475123-40475124 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Feb 29, 2024	Feb 28, 2024	Aug 8, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_139276.3:c.1775AGCGGG[3] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_644805.1:p.Arg595_Ala596insGluArg	inframe insertion
NM_001369512.1:c.1775AGCGGG[3]	NP_001356441.1:p.Arg595_Ala596insGluArg	inframe insertion
NM_001369513.1:c.1775AGCGGG[3]	NP_001356442.1:p.Arg595_Ala596insGluArg	inframe insertion
NM_001369514.1:c.1775AGCGGG[3]	NP_001356443.1:p.Arg595_Ala596insGluArg	inframe insertion
NM_001369516.1:c.1775AGCGGG[3]	NP_001356445.1:p.Arg595_Ala596insGluArg	inframe insertion
NM_001369517.1:c.1775AGCGGG[3]	NP_001356446.1:p.Arg595_Ala596insGluArg	inframe insertion
NM_001369518.1:c.1775AGCGGG[3]	NP_001356447.1:p.Arg595_Ala596insGluArg	inframe insertion
NM_001369519.1:c.1775AGCGGG[3]	NP_001356448.1:p.Arg595_Ala596insGluArg	inframe insertion
NM_001369520.1:c.1775AGCGGG[3]	NP_001356449.1:p.Arg595_Ala596insGluArg	inframe insertion
NM_001384984.1:c.1691AGCGGG[3]	NP_001371913.1:p.Arg567_Ala568insGluArg	inframe insertion
NM_001384985.1:c.1697AGCGGG[3]	NP_001371914.1:p.Arg569_Ala570insGluArg	inframe insertion
NM_001384986.1:c.1790AGCGGG[3]	NP_001371915.1:p.Arg600_Ala601insGluArg	inframe insertion
NM_001384987.1:c.1754AGCGGG[3]	NP_001371916.1:p.Arg588_Ala589insGluArg	inframe insertion
NM_001384988.1:c.1775AGCGGG[3]	NP_001371917.1:p.Arg595_Ala596insGluArg	inframe insertion
NM_001384989.1:c.1679AGCGGG[3]	NP_001371918.1:p.Arg563_Ala564insGluArg	inframe insertion
NM_001384990.1:c.1790AGCGGG[3]	NP_001371919.1:p.Arg600_Ala601insGluArg	inframe insertion
NM_001384991.1:c.1748AGCGGG[3]	NP_001371920.1:p.Arg586_Ala587insGluArg	inframe insertion
NM_001384992.1:c.1715AGCGGG[3]	NP_001371921.1:p.Arg575_Ala576insGluArg	inframe insertion
NM_001384993.1:c.1775AGCGGG[3]	NP_001371922.1:p.Arg595_Ala596insGluArg	inframe insertion
NM_003150.4:c.1775AGCGGG[3]	NP_003141.2:p.Arg595_Ala596insGluArg	inframe insertion
NM_213662.2:c.1775AGCGGG[3]	NP_998827.1:p.Arg595_Ala596insGluArg	inframe insertion
NC_000017.11:g.42323108CGCTCC[3]
NC_000017.10:g.40475126CGCTCC[3]
NG_007370.1:g.70379AGCGGG[3]
LRG_112:g.70379AGCGGG[3]
LRG_112t1:c.1773_1778GGAGCG[3]	LRG_112p1:p.Arg595_Ala596insGluArg

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000017.11:42323105:CCCGCTCCCGCTCC:CCCGCTCCCGCTCCCGCTCC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
STAT3		-	-	GRCh38 GRCh37	714	767

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Hyper-IgE recurrent infection syndrome 1, autosomal dominant STAT3 gain of function	Uncertain significance (1)	criteria provided, single submitter	Aug 8, 2023	RCV003804971.2

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Uncertain significance (Aug 08, 2023)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	STAT3 gain of function Hyper-IgE recurrent infection syndrome 1, autosomal dominant Explanation for multiple conditions: Uncertain. The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases. Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV004608479.1 First in ClinVar: Feb 28, 2024 Last updated: Feb 28, 2024	Comment: This variant, c.1781_1786dup, results in the insertion of 2 amino acid(s) of the STAT3 protein (p.Glu594_Arg595dup), but otherwise preserves the integrity of the reading frame. … (more) This variant, c.1781_1786dup, results in the insertion of 2 amino acid(s) of the STAT3 protein (p.Glu594_Arg595dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with STAT3-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. (less)

Comment:

This variant, c.1781_1786dup, results in the insertion of 2 amino acid(s) of the STAT3 protein (p.Glu594_Arg595dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with STAT3-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for this variant ...

Record last updated Sep 30, 2024

ClinVar Genomic variation as it relates to human health

NM_139276.3(STAT3):c.1775AGCGGG[3] (p.Arg595_Ala596insGluArg)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...