ClinVar Genomic variation as it relates to human health
NM_000218.3(KCNQ1):c.160_168dup (p.Ile54_Pro56dup)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Uncertain significance(2); Benign(4); Likely benign(4)
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000218.3(KCNQ1):c.160_168dup (p.Ile54_Pro56dup)
Variation ID: 42487 Accession: VCV000042487.24
- Type and length
-
Duplication, 9 bp
- Location
-
Cytogenetic: 11p15.5 11: 2445250-2445251 (GRCh38) [ NCBI UCSC ] 11: 2466480-2466481 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline May 5, 2014 Mar 16, 2024 Jan 29, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000218.3:c.160_168dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000209.2:p.Ile54_Pro56dup inframe insertion NM_000218.2:c.160_168dupATCGCGCCC NC_000011.10:g.2445258_2445266dup NC_000011.9:g.2466488_2466496dup NG_008935.1:g.5268_5276dup LRG_287:g.5268_5276dup - Protein change
- Other names
- p.Ile54_Pro56dup
- Canonical SPDI
- NC_000011.10:2445250:CGCGCCCATCGCGCCC:CGCGCCCATCGCGCCCATCGCGCCC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
0.00879 (CGCGCCCATCGCGCCCATCGCGCCC)
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
KCNQ1 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh38 GRCh37 |
1696 | 2580 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Benign/Likely benign (3) |
criteria provided, multiple submitters, no conflicts
|
Mar 28, 2022 | RCV000035343.14 | |
Pathogenic (1) |
no assertion criteria provided
|
Jan 1, 2010 | RCV000114749.3 | |
Uncertain significance (2) |
criteria provided, single submitter
|
Mar 2, 2013 | RCV000250643.3 | |
Likely benign (1) |
criteria provided, single submitter
|
May 20, 2019 | RCV000852643.1 | |
Benign (1) |
criteria provided, single submitter
|
Jan 29, 2024 | RCV001080143.7 | |
Benign/Likely benign (2) |
criteria provided, multiple submitters, no conflicts
|
Sep 21, 2023 | RCV001719723.5 | |
Likely benign (1) |
criteria provided, single submitter
|
Mar 9, 2020 | RCV003914916.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Benign
(May 18, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: not provided
Allele origin:
germline
|
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Accession: SCV000058991.5
First in ClinVar: May 03, 2013 Last updated: Apr 09, 2018 |
Comment:
p.Ile54_Pro56dup in Exon 1 of KCNQ1: This variant is not expected to have clinic al significance because it has been identified in 2.9% (250/8370) of … (more)
p.Ile54_Pro56dup in Exon 1 of KCNQ1: This variant is not expected to have clinic al significance because it has been identified in 2.9% (250/8370) of African ch romosomes by the Genome Aggregation Database (gnomAD, http://gnomad.broadinstitu te.org; dbSNP rs561562768). It has been reported in two individuals with cardia c arrhythmias (1/182 LQTS, Berge 2008; 1/231 AF, Abraham 2010) and segregated in three affected individuals in one family, though phenotypes were unknown in 2 o ther mutation carriers (Abraham 2010). In addition, one study demonstrated some alteration of channel properties (Abraham 2010) although this study was only in vitro such that correlation to a clinical phenotype was not possible. This varia nt was also identified in several healthy control cohorts (0.3% 4/1488 chromosom es, Ackerman 2003; 1/364 chromosomes, Arnestad 2007; 2.1% (2/94) African-America n control chromosomes, Abraham 2010) and is now listed in the KCNQ1 database as a benign variant (http://www.fsm.it/cardmoc/kvlqt1poly.htm). In summary, given t he high frequency of the variant in spite of the reports in the literature, this variant is benign for a reasonably penetrant disease variant and insufficient b iological evidence for a clinically relevant impact to protein function, we have classified this variant as likely benign. (less)
Number of individuals with the variant: 13
|
|
Benign
(Jul 17, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000234378.8
First in ClinVar: Jul 05, 2015 Last updated: Mar 04, 2023 |
Comment:
This variant is associated with the following publications: (PMID: 18752142, 14661677, 17210839, 19646991, 28438721, 32048431, 30847666)
|
|
Likely benign
(Mar 09, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
KCNQ1-related condition
Affected status: unknown
Allele origin:
germline
|
PreventionGenetics, part of Exact Sciences
Accession: SCV004733435.1
First in ClinVar: Mar 16, 2024 Last updated: Mar 16, 2024 |
Comment:
This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications).
|
|
Benign
(Aug 17, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Eurofins Ntd Llc (ga)
Accession: SCV000343643.2
First in ClinVar: Dec 06, 2016 Last updated: Dec 06, 2016 |
Number of individuals with the variant: 1
Sex: mixed
|
|
Likely benign
(May 20, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
Ventricular fibrillation
Affected status: yes
Allele origin:
germline
|
Center for Advanced Laboratory Medicine, UC San Diego Health, University of California San Diego
Accession: SCV000995348.1
First in ClinVar: Oct 12, 2019 Last updated: Oct 12, 2019 |
Number of individuals with the variant: 1
|
|
Likely benign
(Mar 28, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV001372409.2
First in ClinVar: Jul 16, 2020 Last updated: Apr 23, 2022 |
Comment:
Variant summary: KCNQ1 c.160_168dupATCGCGCCC (p.Ile54_Pro56dup) results in an in-frame duplication that is predicted to duplicate 3 amino acids into the encoded protein. The variant allele … (more)
Variant summary: KCNQ1 c.160_168dupATCGCGCCC (p.Ile54_Pro56dup) results in an in-frame duplication that is predicted to duplicate 3 amino acids into the encoded protein. The variant allele was found at a frequency of 0.0073 in 35616 control chromosomes, predominantly at a frequency of 0.03 within the African or African-American subpopulation in the gnomAD database, including 3 homozygotes. The observed variant frequency within African or African-American control individuals in the gnomAD database is approximately 300 fold of the estimated maximal expected allele frequency for a pathogenic variant in KCNQ1 causing Arrhythmia phenotype (0.0001), strongly suggesting that the variant is a benign polymorphism found primarily in populations of African or African-American origin. c.160_168dupATCGCGCCC has been reported in the literature in individuals affected with Arrhythmia as well as in control population (e.g. Abraham_2010, Berge_2008, Ackerman_2003, Tester_2005_01, Kapa_2009, Hassnan_2017, Millat_2014). In a family with familial atrial fibrillation, this variant was found in four affected members and also in an unaffected carrier suggesting an inconclusive co-segregation of this variant with disease (Abraham_2010). This family however, was not comprehensively screened for mutations in all susceptibility genes. Co-occurrences with other pathogenic variants have been reported (KCNQ1 c.674C>T, p.Ser225Leu; KCNH2 c.1841C>T, p.Ala614Val) in our internal database. In vitro functional study detected partial defect of the channel properties (Abraham_2010), suggesting that it could be a functional polymorphism. Five ClinVar submitters (evaluation after 2014) cite the variant as likely benign (n=1) or benign (n=4). Based on the evidence outlined above, the variant was classified as likely benign. (less)
|
|
Uncertain significance
(Feb 27, 2013)
|
criteria provided, single submitter
Method: clinical testing
|
cardiovascular phenotype
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV000318444.2
First in ClinVar: Oct 03, 2016 Last updated: Dec 11, 2022 |
Number of individuals with the variant: 1
|
|
Uncertain significance
(Mar 02, 2013)
|
criteria provided, single submitter
Method: clinical testing
|
cardiovascular phenotype
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV000318524.2
First in ClinVar: Oct 02, 2016 Last updated: Dec 11, 2022 |
Number of individuals with the variant: 1
|
|
Benign
(Jan 29, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Long QT syndrome
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV000259853.11
First in ClinVar: Jan 31, 2016 Last updated: Feb 14, 2024 |
|
|
Likely benign
(Sep 21, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
Accession: SCV003799325.3
First in ClinVar: Feb 13, 2023 Last updated: Feb 20, 2024 |
|
|
Pathogenic
(Jan 01, 2010)
|
no assertion criteria provided
Method: literature only
|
ATRIAL FIBRILLATION, FAMILIAL, 3
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000148632.2
First in ClinVar: Apr 19, 2014 Last updated: May 05, 2014 |
Comment on evidence:
In affected members of a Caucasian kindred segregating autosomal dominant early-onset lone atrial fibrillation (ATFB3; 607554), Abraham et al. (2010) identified heterozygosity for a 9-bp … (more)
In affected members of a Caucasian kindred segregating autosomal dominant early-onset lone atrial fibrillation (ATFB3; 607554), Abraham et al. (2010) identified heterozygosity for a 9-bp duplication in the KCNQ1 gene, resulting in insertion of isoleucine, alanine, and proline at positions 54 to 56. The duplication was present in all 4 affected family members and in 2 symptomatic family members in whom atrial fibrillation had not yet been documented. It was not found in 3 unaffected family members or in Caucasian, Han Chinese, and Asian population controls; however, the duplication was detected in 2 (2.1%) of 94 African American control chromosomes that had been obtained from the anonymous Coriell repository, for which no clinical information was available. Functional analysis in CHO cells demonstrated that coexpression of mutant KCNQ1 with its ancillary subunit KCNE1 (176261) generated approximately 3-fold larger currents that also activated much earlier than wildtype currents. The mutant accelerated both activation and deactivation over all voltages. (less)
|
|
click to load more click to collapse |
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Clinical profile and mutation spectrum of long QT syndrome in Saudi Arabia: The impact of consanguinity. | Al-Hassnan ZN | Heart rhythm | 2017 | PMID: 28438721 |
Evaluation of a new high-throughput next-generation sequencing method based on a custom AmpliSeq™ library and ion torrent PGM™ sequencing for the rapid detection of genetic variations in long QT syndrome. | Millat G | Molecular diagnosis & therapy | 2014 | PMID: 24687331 |
Tox-database.net: a curated resource for data describing chemical triggered in vitro cardiac ion channels inhibition. | Polak S | BMC pharmacology & toxicology | 2012 | PMID: 22947121 |
Chromosome 4q25 variants are genetic modifiers of rare ion channel mutations associated with familial atrial fibrillation. | Ritchie MD | Journal of the American College of Cardiology | 2012 | PMID: 22818067 |
Augmented potassium current is a shared phenotype for two genetic defects associated with familial atrial fibrillation. | Abraham RL | Journal of molecular and cellular cardiology | 2010 | PMID: 19646991 |
Genetic testing for long-QT syndrome: distinguishing pathogenic mutations from benign variants. | Kapa S | Circulation | 2009 | PMID: 19841300 |
Molecular genetic analysis of long QT syndrome in Norway indicating a high prevalence of heterozygous mutation carriers. | Berge KE | Scandinavian journal of clinical and laboratory investigation | 2008 | PMID: 18752142 |
Prevalence of long-QT syndrome gene variants in sudden infant death syndrome. | Arnestad M | Circulation | 2007 | PMID: 17210839 |
Sudden infant death syndrome: how significant are the cardiac channelopathies? | Tester DJ | Cardiovascular research | 2005 | PMID: 15913580 |
Ethnic differences in cardiac potassium channel variants: implications for genetic susceptibility to sudden cardiac death and genetic testing for congenital long QT syndrome. | Ackerman MJ | Mayo Clinic proceedings | 2003 | PMID: 14661677 |
Text-mined citations for rs397515877 ...
HelpRecord last updated Mar 17, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.