ClinVar Genomic variation as it relates to human health
NM_023067.4(FOXL2):c.672_701dup (p.Ala225_Ala234dup)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_023067.4(FOXL2):c.672_701dup (p.Ala225_Ala234dup)
Variation ID: 4854 Accession: VCV000004854.5
- Type and length
-
Duplication, 30 bp
- Location
-
Cytogenetic: 3q22.3 3: 138946021-138946022 (GRCh38) [ NCBI UCSC ] 3: 138664863-138664864 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Apr 4, 2013 Feb 28, 2024 Dec 5, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_023067.4:c.672_701dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_075555.1:p.Ala225_Ala234dup inframe insertion NC_000003.12:g.138946030_138946059dup NC_000003.11:g.138664872_138664901dup NG_012454.1:g.6090_6119dup NG_029796.1:g.3797_3826dup LRG_1295:g.6090_6119dup LRG_1295t1:c.672_701dup LRG_1295p1:p.Ala225_Ala234dup - Protein change
- Other names
- -
- Canonical SPDI
- NC_000003.12:138946021:GCGGCTGCAGCCGCAGCTGCTGCAGCCGCTGCGGCTGC:GCGGCTGCAGCCGCAGCTGCTGCAGCCGCTGCGGCTGCAGCCGCAGCTGCTGCAGCCGCTGCGGCTGC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
FOXL2 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
232 | 267 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
no assertion criteria provided
|
Dec 1, 2005 | RCV000005128.3 | |
Pathogenic (1) |
no assertion criteria provided
|
Dec 1, 2005 | RCV000005127.3 | |
Pathogenic (3) |
criteria provided, multiple submitters, no conflicts
|
Jul 17, 2023 | RCV000408801.3 | |
Pathogenic (1) |
criteria provided, single submitter
|
Dec 5, 2023 | RCV002512795.3 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Nov 03, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
Affected status: yes
Allele origin:
germline
|
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics, Children's Hospital of Philadelphia
Accession: SCV000484884.1
First in ClinVar: Dec 18, 2016 Last updated: Dec 18, 2016
Comment:
Clinical Testing
|
Number of individuals with the variant: 28
|
|
Pathogenic
(Jan 01, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
unknown,
inherited,
de novo,
paternal
|
Wessex Regional Genetics Laboratory, Salisbury District Hospital
Accession: SCV000924431.1
First in ClinVar: Jun 23, 2019 Last updated: Jun 23, 2019 |
Observation 1:
Number of individuals with the variant: 1
Observation 2:
Number of individuals with the variant: 1
Observation 3:
Number of individuals with the variant: 1
Observation 4:
Number of individuals with the variant: 1
Observation 5:
Number of individuals with the variant: 1
Observation 6:
Number of individuals with the variant: 1
Observation 7:
Number of individuals with the variant: 1
Observation 8:
Number of individuals with the variant: 1
Observation 9:
Number of individuals with the variant: 1
Observation 10:
Number of individuals with the variant: 1
Observation 11:
Number of individuals with the variant: 1
Observation 12:
Number of individuals with the variant: 1
Observation 13:
Number of individuals with the variant: 1
Observation 14:
Number of individuals with the variant: 1
Observation 15:
Number of individuals with the variant: 1
Observation 16:
Number of individuals with the variant: 1
Observation 17:
Number of individuals with the variant: 1
Observation 18:
Number of individuals with the variant: 1
Observation 19:
Number of individuals with the variant: 1
Observation 20:
Number of individuals with the variant: 1
Observation 21:
Number of individuals with the variant: 1
Observation 22:
Number of individuals with the variant: 1
Observation 23:
Number of individuals with the variant: 1
Observation 24:
Number of individuals with the variant: 1
Observation 25:
Number of individuals with the variant: 1
Observation 26:
Number of individuals with the variant: 1
|
|
Pathogenic
(Jul 17, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Blepharophimosis, ptosis, and epicanthus inversus syndrome
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
unknown
|
Institute of Human Genetics, University of Leipzig Medical Center
Accession: SCV004027630.1
First in ClinVar: Aug 26, 2023 Last updated: Aug 26, 2023 |
Comment:
Criteria applied: PS4,PP1_STR,PM4,PM2_SUP,PP4
Clinical Features:
Abnormal eyelid morphology (present) , Global developmental delay (present)
Sex: male
|
|
Pathogenic
(Dec 05, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV002986554.2
First in ClinVar: Feb 07, 2023 Last updated: Feb 28, 2024 |
Comment:
This variant, c.672_701dup, results in the insertion of 10 amino acid(s) of the FOXL2 protein (p.Ala225_Ala234dup), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.672_701dup, results in the insertion of 10 amino acid(s) of the FOXL2 protein (p.Ala225_Ala234dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with blepharophimosis (PMID: 17277738, 18484667). It has also been observed to segregate with disease in related individuals. This variant is also known as p.224_234dup10. ClinVar contains an entry for this variant (Variation ID: 4854). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
Pathogenic
(Dec 01, 2005)
|
no assertion criteria provided
Method: literature only
|
BLEPHAROPHIMOSIS, PTOSIS, AND EPICANTHUS INVERSUS, TYPE II
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000025304.1
First in ClinVar: Apr 04, 2013 Last updated: Apr 04, 2013 |
Comment on evidence:
In affected members of 2 families with BPES type II (110100), and in a sporadic male BPES patient, Crisponi et al. (2001) identified a 30-bp … (more)
In affected members of 2 families with BPES type II (110100), and in a sporadic male BPES patient, Crisponi et al. (2001) identified a 30-bp duplication at position 909 to 938. Amino acids 224 to 234 were duplicated. In the 2 families with multiple cases, affected females transmitted the trait to the next generation. Ramirez-Castro et al. (2002) identified this mutation in affected members of 2 families with BPES type II from a historically isolated population in northwest Colombia. The genotype/phenotype correlation in the families was consistent with a proposal that BPES type I is caused by truncating mutations leading to haploinsufficiency, while BPES type II is caused by mutations generating elongated protein products (see also 605597.0008). This duplication has also been described as recurrent in unrelated familial and sporadic BPES cases in Europe; its recurrence may be related to the secondary structure of the particular DNA region. In both a family and sporadic case of BPES type II from Algeria, Dollfus et al. (2003) identified this mutation. In an 18-month-old girl with sporadic BPES and bilateral type 1 Duane syndrome (see 126800), Vincent et al. (2005) identified heterozygosity for a 30-bp duplication, which they designated 672_701dup30 based on numbering from the ATG start codon, resulting in a duplication of 10 alanine residues at codon 224 in the FOXL2 gene. (less)
|
|
Pathogenic
(Dec 01, 2005)
|
no assertion criteria provided
Method: literature only
|
BLEPHAROPHIMOSIS, PTOSIS, AND EPICANTHUS INVERSUS, TYPE II WITH DUANE RETRACTION SYNDROME
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000025305.1
First in ClinVar: Apr 04, 2013 Last updated: Apr 04, 2013 |
Comment on evidence:
In affected members of 2 families with BPES type II (110100), and in a sporadic male BPES patient, Crisponi et al. (2001) identified a 30-bp … (more)
In affected members of 2 families with BPES type II (110100), and in a sporadic male BPES patient, Crisponi et al. (2001) identified a 30-bp duplication at position 909 to 938. Amino acids 224 to 234 were duplicated. In the 2 families with multiple cases, affected females transmitted the trait to the next generation. Ramirez-Castro et al. (2002) identified this mutation in affected members of 2 families with BPES type II from a historically isolated population in northwest Colombia. The genotype/phenotype correlation in the families was consistent with a proposal that BPES type I is caused by truncating mutations leading to haploinsufficiency, while BPES type II is caused by mutations generating elongated protein products (see also 605597.0008). This duplication has also been described as recurrent in unrelated familial and sporadic BPES cases in Europe; its recurrence may be related to the secondary structure of the particular DNA region. In both a family and sporadic case of BPES type II from Algeria, Dollfus et al. (2003) identified this mutation. In an 18-month-old girl with sporadic BPES and bilateral type 1 Duane syndrome (see 126800), Vincent et al. (2005) identified heterozygosity for a 30-bp duplication, which they designated 672_701dup30 based on numbering from the ATG start codon, resulting in a duplication of 10 alanine residues at codon 224 in the FOXL2 gene. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Differential functional effects of novel mutations of the transcription factor FOXL2 in BPES patients. | Nallathambi J | Human mutation | 2008 | PMID: 18484667 |
FOXL2 mutations in Chinese patients with blepharophimosis-ptosis-epicanthus inversus syndrome. | Wang J | Molecular vision | 2007 | PMID: 17277738 |
Blepharophimosis and bilateral Duane syndrome associated with a FOXL2 mutation. | Vincent AL | Clinical genetics | 2005 | PMID: 16283882 |
Sporadic and familial blepharophimosis -ptosis-epicanthus inversus syndrome: FOXL2 mutation screen and MRI study of the superior levator eyelid muscle. | Dollfus H | Clinical genetics | 2003 | PMID: 12630957 |
Mutations in FOXL2 underlying BPES (types 1 and 2) in Colombian families. | Ramírez-Castro JL | American journal of medical genetics | 2002 | PMID: 12400065 |
The putative forkhead transcription factor FOXL2 is mutated in blepharophimosis/ptosis/epicanthus inversus syndrome. | Crisponi L | Nature genetics | 2001 | PMID: 11175783 |
Text-mined citations for rs387906321 ...
HelpRecord last updated May 08, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.