VCV000004868.14 - ClinVar

NM_023067.4(FOXL2):c.663_692del (p.Ala225_Ala234del)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(2)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Likely pathogenic

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_023067.4(FOXL2):c.663_692del (p.Ala225_Ala234del)

Variation ID: 4868 Accession: VCV000004868.14

Type and length

Deletion, 30 bp

Location

Cytogenetic: 3q22.3 3: 138946031-138946060 (GRCh38) [ NCBI UCSC ] 3: 138664873-138664902 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Apr 21, 2017	Oct 20, 2024	Apr 1, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_023067.4:c.663_692del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_075555.1:p.Ala225_Ala234del	inframe deletion
NC_000003.12:g.138946034_138946063del
NC_000003.11:g.138664876_138664905del
NG_012454.1:g.6081_6110del
NG_029796.1:g.3801_3830del
LRG_1295:g.6081_6110del
LRG_1295t1:c.663_692del	LRG_1295p1:p.Ala225_Ala234del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000003.12:138946030:GCCGCAGCTGCTGCAGCCGCTGCGGCTGCCGCC:GCC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

OMIM: 605597.0016 VarSome

Comment on variant

NCBI staff provided HGVS expressions for allelic variant 605597.0016 based on the sequence reported in Figure 2 of the paper by Harris et al., 2002 (PubMed 12149404).

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
FOXL2		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh37	238	273

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Premature ovarian failure 3	Pathogenic (1)	no assertion criteria provided	Aug 1, 2002	RCV000005144.4
not provided	Likely pathogenic (1)	criteria provided, single submitter	Apr 1, 2023	RCV003311650.12

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (Apr 01, 2023)	criteria provided, single submitter (CeGaT Center For Human Genetics Tuebingen Variant Classification Criteria Version 2) Method: clinical testing	not provided Affected status: yes Allele origin: germline	CeGaT Center for Human Genetics Tuebingen Accession: SCV004011495.12 First in ClinVar: Jul 16, 2023 Last updated: Oct 20, 2024	Comment: FOXL2: PM2, PM4, PS4:Moderate Number of individuals with the variant: 1
Pathogenic (Aug 01, 2002)	no assertion criteria provided Method: literature only	PREMATURE OVARIAN FAILURE 3 Affected status: not provided Allele origin: germline	OMIM Accession: SCV000025321.2 First in ClinVar: Apr 04, 2013 Last updated: Apr 21, 2017	Publications: PubMed (1) PubMed: 12149404 Comment on evidence: In 70 patients from New Zealand and Slovenia with premature ovarian failure (608996), Harris et al. (2002) screened the FOXL2 gene for causative mutations; in … (more) In 70 patients from New Zealand and Slovenia with premature ovarian failure (608996), Harris et al. (2002) screened the FOXL2 gene for causative mutations; in a Slovenian patient with POF3 (608996), they identified a heterozygous 30-bp deletion (898_927del) that removed 10 of the 14 alanines from a polyalanine tract downstream of the winged helix/forkhead domain of the protein (A221_A230del). Harris et al. (2002) stated that this was the first report of a deletion within a polyalanine tract being associated with a disease phenotype, although polyalanine expansions are known to be causative in several conditions; for example, in some families with BPES type II (110100), the polyalanine tract of FOXL2 has been shown to be expanded (605597.0010). (less)

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Identification of novel mutations in FOXL2 associated with premature ovarian failure.	Harris SE	Molecular human reproduction	2002	PMID: 12149404

Text-mined citations for this variant ...

Record last updated Oct 20, 2024

ClinVar Genomic variation as it relates to human health

NM_023067.4(FOXL2):c.663_692del (p.Ala225_Ala234del)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...