ClinVar Genomic variation as it relates to human health
Help
- Interpretation:
-
Pathogenic
- Review status:
- no assertion criteria provided
- Submissions:
- 1
- First in ClinVar:
- Apr 4, 2013
- Most recent Submission:
- Apr 4, 2013
- Last evaluated:
- Dec 1, 2005
- Accession:
- VCV000006721.1
- Variation ID:
- 6721
- Description:
- 27bp deletion
Help
NM_006079.5(CITED2):c.510_536del (p.163GSSTPGGSG[1])
- Allele ID
- 21760
- Variant type
- Deletion
- Variant length
- 27 bp
- Cytogenetic location
- 6q24.1
- Genomic location
- 6: 139373409-139373435 (GRCh38) GRCh38 UCSC
- 6: 139694546-139694572 (GRCh37) GRCh37 UCSC
- HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_006079.5:c.510_536del MANE Select NP_006070.2:p.163GSSTPGGSG[1] inframe deletion NM_001168388.3:c.510_536del NP_001161860.1:p.163GSSTPGGSG[1] inframe deletion NM_001168389.3:c.525_551del NP_001161861.2:p.168GSSTPGGSG[1] inframe deletion NC_000006.12:g.139373435_139373461del NC_000006.11:g.139694572_139694598del NG_016169.1:g.6214_6240del - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000006.12:139373408:GAGCCGCCGGGGGTGCTGCTGCCGCCCGAGCCGCCGGGGGTGCTGCTGCCGCC:GAGCCGCCGGGGGTGCTGCTGCCGCC
- Functional consequence
- -
- Global minor allele frequency (GMAF)
- -
- Allele frequency
- -
- Links
- OMIM: 602937.0001
- VarSome
Help
Aggregate interpretations per condition
| Interpreted condition | Interpretation | Number of submissions | Review status | Last evaluated | Variation/condition record |
|---|---|---|---|---|---|
| Pathogenic | 1 | no assertion criteria provided | Dec 1, 2005 | RCV000007113.2 |
Help
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation | Variation viewer | Related variants | ||
|---|---|---|---|---|---|---|
| HI score Help | TS score Help | Within gene | All | |||
| CITED2 | Some evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
42 | 59 | |
Submitted interpretations and evidence
Help| Interpretation (Last evaluated) |
Review status (Assertion criteria) |
Condition (Inheritance) |
Submitter | More information | |
|---|---|---|---|---|---|
|
Pathogenic
(Dec 01, 2005)
|
no assertion criteria provided
Method: literature only
|
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000027309.1
First in ClinVar: Apr 04, 2013 Last updated: Apr 04, 2013 |
Comment on evidence:
In a patient with perimembranous ventricular septal defect (VSD2; 614431), Sperling et al. (2005) identified heterozygosity for a 27-bp deletion (508_534del27) in exon 2 of … (more)
In a patient with perimembranous ventricular septal defect (VSD2; 614431), Sperling et al. (2005) identified heterozygosity for a 27-bp deletion (508_534del27) in exon 2 of the CITED2 gene, resulting in deletion of 9 amino acid residues (ser170_gly178del). The mutation was not found in 192 controls. Analysis of reporter gene transactivation and repression revealed that the 27-bp deletion reduced coactivation of the TFAP2C gene (601602) to 50% of that obtained with wildtype and repressed HIF1A (603348) with about 60% efficiency compared to wildtype. (less)
|
Functional evidence
Help| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Identification and functional analysis of CITED2 mutations in patients with congenital heart defects. | Sperling S | Human mutation | 2005 | PMID: 16287139 |
Record last updated Jul 02, 2022