VCV000008129.1 - ClinVar

NM_004970.3(IGFALS):c.583_591dup (p.Ser195_Arg197dup)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

no assertion criteria provided

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_004970.3(IGFALS):c.583_591dup (p.Ser195_Arg197dup)

Variation ID: 8129 Accession: VCV000008129.1

Type and length

Duplication, 9 bp

Location

Cytogenetic: 16p13.3 16: 1791826-1791827 (GRCh38) [ NCBI UCSC ] 16: 1841827-1841828 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Aug 20, 2015	Aug 20, 2015	Nov 1, 2007

HGVS

Nucleotide	Protein	Molecular consequence
NM_004970.3:c.583_591dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_004961.1:p.Ser195_Arg197dup	inframe insertion
NM_001146006.2:c.697_705dup	NP_001139478.1:p.Ser233_Arg235dup	inframe insertion
NR_027389.1:n.637_645dup		non-coding transcript variant
NC_000016.10:g.1791829_1791837dup
NC_000016.9:g.1841830_1841838dup
NG_011778.1:g.6899_6907dup

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000016.10:1791826:GCGCAGGCTGC:GCGCAGGCTGCGCAGGCTGC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA119310 OMIM: 601489.0003 dbSNP: rs606231171 VarSome

Comment on variant

NCBI staff reviewed the sequence information reported in PubMed 17726072 Fig. 5A to determine the location of this allele on the current reference sequence.

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
IGFALS		-	-	GRCh38 GRCh37	195	249

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Short stature due to primary acid-labile subunit deficiency	Pathogenic (1)	no assertion criteria provided	Nov 1, 2007	RCV000008602.4

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Nov 01, 2007)	no assertion criteria provided Method: literature only	ACID-LABILE SUBUNIT DEFICIENCY Affected status: not provided Allele origin: germline	OMIM Accession: SCV000028810.3 First in ClinVar: Apr 04, 2013 Last updated: Aug 20, 2015	Publications: PubMed (1) PubMed: 17726072 Comment on evidence: For discussion of the 9-bp duplication in the IGFALS gene (c.583_591dup9) that was found in compound heterozygous state in sibs with complete acid-labile subunit deficiency … (more) For discussion of the 9-bp duplication in the IGFALS gene (c.583_591dup9) that was found in compound heterozygous state in sibs with complete acid-labile subunit deficiency (ACLSD; 615961) by Domene et al. (2007), see 601489.0002. (less)

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Phenotypic effects of null and haploinsufficiency of acid-labile subunit in a family with two novel IGFALS gene mutations.	Domené HM	The Journal of clinical endocrinology and metabolism	2007	PMID: 17726072

Text-mined citations for rs606231171 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Apr 25, 2022

ClinVar Genomic variation as it relates to human health

NM_004970.3(IGFALS):c.583_591dup (p.Ser195_Arg197dup)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs606231171 ...