ClinVar Genomic variation as it relates to human health
Help
- Interpretation:
-
Pathogenic
- Review status:
- no assertion criteria provided
- Submissions:
- 1
- First in ClinVar:
- Apr 4, 2013
- Most recent Submission:
- Apr 4, 2013
- Last evaluated:
- Apr 1, 2005
- Accession:
- VCV000008948.1
- Variation ID:
- 8948
- Description:
- 21bp deletion
Help
NM_001319206.4(MEF2A):c.1313_1333del (p.Gln438_Pro444del)
- Allele ID
- 23987
- Variant type
- Deletion
- Variant length
- 21 bp
- Cytogenetic location
- 15q26.3
- Genomic location
- 15: 99712565-99712585 (GRCh38) GRCh38 UCSC
- 15: 100252770-100252790 (GRCh37) GRCh37 UCSC
- HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_001319206.4:c.1313_1333del MANE Select NP_001306135.1:p.Gln438_Pro444del inframe deletion NM_001130926.5:c.1289_1309del NP_001124398.1:p.Gln430_Pro436del inframe deletion NM_001130927.5:c.1109_1129del NP_001124399.1:p.Gln370_Pro376del inframe deletion NM_001130928.4:c.1085_1105del NP_001124400.1:p.Gln362_Pro368del inframe deletion NM_001171894.5:c.1289_1309del NP_001165365.1:p.Gln430_Pro436del inframe deletion NM_001352614.4:c.1289_1309del NP_001339543.1:p.Gln430_Pro436del inframe deletion NM_001352615.4:c.1289_1309del NP_001339544.1:p.Gln430_Pro436del inframe deletion NM_001352616.4:c.1313_1333del NP_001339545.1:p.Gln438_Pro444del inframe deletion NM_001352617.4:c.1295_1315del NP_001339546.1:p.Gln432_Pro438del inframe deletion NM_001352618.4:c.1307_1327del NP_001339547.1:p.Gln436_Pro442del inframe deletion NM_001365201.3:c.1331_1351del NP_001352130.1:p.Gln444_Pro450del inframe deletion NM_001365202.3:c.1331_1351del NP_001352131.1:p.Gln444_Pro450del inframe deletion NM_001365203.3:c.1319_1339del NP_001352132.1:p.Gln440_Pro446del inframe deletion NM_001365204.3:c.1319_1339del NP_001352133.1:p.Gln440_Pro446del inframe deletion NM_001365205.3:c.1313_1333del NP_001352134.1:p.Gln438_Pro444del inframe deletion NM_001365206.3:c.1307_1327del NP_001352135.1:p.Gln436_Pro442del inframe deletion NM_001365207.3:c.1295_1315del NP_001352136.1:p.Gln432_Pro438del inframe deletion NM_001365208.3:c.1289_1309del NP_001352137.1:p.Gln430_Pro436del inframe deletion NM_001365209.3:c.1109_1129del NP_001352138.1:p.Gln370_Pro376del inframe deletion NM_001393558.2:c.1091_1111del NP_001380487.1:p.Gln364_Pro370del inframe deletion NM_001393559.2:c.1085_1105del NP_001380488.1:p.Gln362_Pro368del inframe deletion NM_001393560.2:c.974_994del NP_001380489.1:p.Gln325_Pro331del inframe deletion NM_001393561.3:c.485_505del NP_001380490.1:p.Gln162_Pro168del inframe deletion NM_001400028.1:c.1427_1447del NP_001386957.1:p.Gln476_Pro482del inframe deletion NM_001400029.1:c.1319_1339del NP_001386958.1:p.Gln440_Pro446del inframe deletion NM_001400030.1:c.1319_1339del NP_001386959.1:p.Gln440_Pro446del inframe deletion NM_001400031.1:c.1313_1333del NP_001386960.1:p.Gln438_Pro444del inframe deletion NM_001400032.1:c.1313_1333del NP_001386961.1:p.Gln438_Pro444del inframe deletion NM_001400033.1:c.1313_1333del NP_001386962.1:p.Gln438_Pro444del inframe deletion NM_001400034.1:c.1313_1333del NP_001386963.1:p.Gln438_Pro444del inframe deletion NM_001400035.1:c.1313_1333del NP_001386964.1:p.Gln438_Pro444del inframe deletion NM_001400036.1:c.1313_1333del NP_001386965.1:p.Gln438_Pro444del inframe deletion NM_001400037.1:c.1307_1327del NP_001386966.1:p.Gln436_Pro442del inframe deletion NM_001400038.1:c.1295_1315del NP_001386967.1:p.Gln432_Pro438del inframe deletion NM_001400039.1:c.1295_1315del NP_001386968.1:p.Gln432_Pro438del inframe deletion NM_001400040.1:c.1295_1315del NP_001386969.1:p.Gln432_Pro438del inframe deletion NM_001400049.1:c.1295_1315del NP_001386978.1:p.Gln432_Pro438del inframe deletion NM_001400050.1:c.1295_1315del NP_001386979.1:p.Gln432_Pro438del inframe deletion NM_001400051.1:c.1295_1315del NP_001386980.1:p.Gln432_Pro438del inframe deletion NM_001400052.1:c.1295_1315del NP_001386981.1:p.Gln432_Pro438del inframe deletion NM_001400053.1:c.1295_1315del NP_001386982.1:p.Gln432_Pro438del inframe deletion NM_001400054.1:c.1289_1309del NP_001386983.1:p.Gln430_Pro436del inframe deletion NM_001400055.1:c.1289_1309del NP_001386984.1:p.Gln430_Pro436del inframe deletion NM_001400056.1:c.1289_1309del NP_001386985.1:p.Gln430_Pro436del inframe deletion NM_001400057.1:c.1289_1309del NP_001386986.1:p.Gln430_Pro436del inframe deletion NM_001400058.1:c.1289_1309del NP_001386987.1:p.Gln430_Pro436del inframe deletion NM_001400059.1:c.1289_1309del NP_001386988.1:p.Gln430_Pro436del inframe deletion NM_001400060.1:c.1289_1309del NP_001386989.1:p.Gln430_Pro436del inframe deletion NM_001400061.1:c.1289_1309del NP_001386990.1:p.Gln430_Pro436del inframe deletion NM_001400062.1:c.1289_1309del NP_001386991.1:p.Gln430_Pro436del inframe deletion NM_001400063.1:c.1289_1309del NP_001386992.1:p.Gln430_Pro436del inframe deletion NM_001400064.1:c.1289_1309del NP_001386993.1:p.Gln430_Pro436del inframe deletion NM_001400065.1:c.1289_1309del NP_001386994.1:p.Gln430_Pro436del inframe deletion NM_001400066.1:c.1289_1309del NP_001386995.1:p.Gln430_Pro436del inframe deletion NM_001400067.1:c.1115_1135del NP_001386996.1:p.Gln372_Pro378del inframe deletion NM_001400068.1:c.1091_1111del NP_001386997.1:p.Gln364_Pro370del inframe deletion NM_001400069.1:c.953_973del NP_001386998.1:p.Gln318_Pro324del inframe deletion NM_005587.6:c.1295_1315del NP_005578.2:p.Gln432_Pro438del inframe deletion NC_000015.10:g.99712566_99712586del NC_000015.9:g.100252771_100252791del NG_016443.2:g.151639_151659del - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000015.10:99712564:CAACCCCCGCAGCCCCAGCCCC:C
- Functional consequence
- -
- Global minor allele frequency (GMAF)
- -
- Allele frequency
- -
- Links
- OMIM: 600660.0001
- VarSome
Help
Aggregate interpretations per condition
| Interpreted condition | Interpretation | Number of submissions | Review status | Last evaluated | Variation/condition record |
|---|---|---|---|---|---|
| Pathogenic | 1 | no assertion criteria provided | Apr 1, 2005 | RCV000009504.4 |
Submitted interpretations and evidence
Help| Interpretation (Last evaluated) |
Review status (Assertion criteria) |
Condition (Inheritance) |
Submitter | More information | |
|---|---|---|---|---|---|
|
Pathogenic
(Apr 01, 2005)
|
no assertion criteria provided
Method: literature only
|
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000029722.1
First in ClinVar: Apr 04, 2013 Last updated: Apr 04, 2013 |
Comment on evidence:
In a large pedigree segregating autosomal dominant coronary artery disease and acute myocardial infarction (608320), Wang et al. (2003) identified a 7-amino acid or 21-bp … (more)
In a large pedigree segregating autosomal dominant coronary artery disease and acute myocardial infarction (608320), Wang et al. (2003) identified a 7-amino acid or 21-bp deletion in exon 11 of the MEF2A gene, resulting in a deletion of QPPQPQP from codons 440 through 446. This mutation was found in all affected members of the family, but in none of the unaffected family members nor in 119 population controls with normal angiograms. Weng et al. (2005) screened approximately 1,800 individuals without CAD for the 21-bp deletion in the MEF2A gene and identified 3 carriers. Genotyping of 19 family members of the 3 mutation-positive controls revealed that the mutation did not cosegregate with early CAD: 3 elderly relatives with the deletion had no evidence of premature CAD, and 2 relatives with premature CAD did not have the mutation. Weng et al. (2005) argued against a role for the MEF2A 21-bp deletion in autosomal dominant CAD. (less)
|
Functional evidence
Help| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Lack of MEF2A mutations in coronary artery disease. | Weng L | The Journal of clinical investigation | 2005 | PMID: 15841183 |
| Mutation of MEF2A in an inherited disorder with features of coronary artery disease. | Wang L | Science (New York, N.Y.) | 2003 | PMID: 14645853 |
Record last updated Oct 15, 2022