VCV000984610.21 - ClinVar

NM_015570.4(AUTS2):c.1603_1626del (p.531HQHT[1])

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(9)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Conflicting classifications of pathogenicity
Pathogenic(4); Uncertain significance(3)

criteria provided, conflicting classifications

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_015570.4(AUTS2):c.1603_1626del (p.531HQHT[1])

Variation ID: 984610 Accession: VCV000984610.21

Type and length

Deletion, 24 bp

Location

Cytogenetic: 7q11.22 7: 70766235-70766258 (GRCh38) [ NCBI UCSC ] 7: 70231221-70231244 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Nov 12, 2020	Oct 8, 2024	Sep 5, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_015570.4:c.1603_1626del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_056385.1:p.531HQHT[1]	inframe deletion
NM_001127231.3:c.1603_1626del	NP_001120703.1:p.531HQHT[1]	inframe deletion
NM_015570.2:c.1603_1626del24
NM_015570.2:c.1603_1626delCACCAGCACACGCACCAGCACACC
NM_015570.3:c.1603_1626del
NM_015570.3:c.1603_1626del24
NC_000007.14:g.70766248_70766271del
NC_000007.13:g.70231234_70231257del
NG_034133.1:g.1172330_1172353del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000007.14:70766234:GCACCAGCACACCCACCAGCACACGCACCAGCACACC:GCACCAGCACACC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

dbSNP: rs1789934246 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
AUTS2		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh37	1040	1109

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
See cases	Pathogenic (1)	criteria provided, single submitter	Apr 26, 2021	RCV001420233.2
Neurodevelopmental abnormality	Likely pathogenic (1)	no assertion criteria provided	Apr 3, 2020	RCV001264706.1
Inborn genetic diseases	Uncertain significance (1)	criteria provided, single submitter	Aug 4, 2020	RCV001266310.4
not provided	Conflicting interpretations of pathogenicity (2)	criteria provided, conflicting classifications	May 23, 2023	RCV001302562.13
Autism spectrum disorder due to AUTS2 deficiency	Conflicting interpretations of pathogenicity (3)	criteria provided, conflicting classifications	Sep 5, 2023	RCV003145502.7
AUTS2-related disorder	Likely pathogenic (1)	no assertion criteria provided	May 2, 2024	RCV004746301.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Apr 26, 2021)	criteria provided, single submitter (Parc Tauli Hospital Assertion Criteria 2021) Method: clinical testing	See cases (Autosomal dominant inheritance) Affected status: yes Allele origin: de novo	Genetics Laboratory, UDIAT-Centre Diagnòstic, Hospital Universitari Parc Tauli Accession: SCV001622653.1 First in ClinVar: May 20, 2021 Last updated: May 20, 2021	Comment: PS3_strong;PM1_moderate;PM2_supporting;PM4_moderate;PM6_moderate;PP3_supporting Clinical Features: Intellectual disability (present) , Atypical behavior (present) , Global developmental delay (present) , Abnormal facial shape (present) , Cerebellar vermis hypoplasia (present) , Delayed speech … (more) Intellectual disability (present) , Atypical behavior (present) , Global developmental delay (present) , Abnormal facial shape (present) , Cerebellar vermis hypoplasia (present) , Delayed speech and language development (present) , Sleep abnormality (present) , Polyphagia (present) , Compulsive behaviors (present) , Autistic behavior (present) , Aggressive behavior (present) (less) Sex: female
Pathogenic (Apr 20, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: research	Autism spectrum disorder due to AUTS2 deficiency Affected status: yes Allele origin: de novo	Duke University Health System Sequencing Clinic, Duke University Health System Accession: SCV003918963.1 First in ClinVar: Apr 30, 2023 Last updated: Apr 30, 2023
Pathogenic (May 23, 2023)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV001770714.4 First in ClinVar: Aug 07, 2021 Last updated: Jun 03, 2023	Comment: Not observed in large population cohorts (gnomAD); In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: … (more) Not observed in large population cohorts (gnomAD); In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: (PMID: 35032046, 33562463) (less)
Pathogenic (Sep 05, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Autism spectrum disorder due to AUTS2 deficiency Affected status: unknown Allele origin: unknown	Baylor Genetics Accession: SCV004183488.1 First in ClinVar: Dec 24, 2023 Last updated: Dec 24, 2023
Uncertain significance (Mar 16, 2020)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Autism spectrum disorder due to AUTS2 deficiency Affected status: unknown Allele origin: germline	Revvity Omics, Revvity Accession: SCV003834547.2 First in ClinVar: Mar 04, 2023 Last updated: Feb 04, 2024
Uncertain significance (May 01, 2023)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV001491776.4 First in ClinVar: Mar 07, 2021 Last updated: Feb 14, 2024	Publications: PubMed (2) PubMed: 33562463‚ 35032046 Comment: In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant … (more) In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 984610). This variant has been observed in individual(s) with AUTS2 syndrome and/or clinical features of AUTS2-related conditions (PMID: 33562463, 35032046). In at least one individual the variant was observed to be de novo. This variant is not present in population databases (gnomAD no frequency). This variant, c.1603_1626del, results in the deletion of 8 amino acid(s) of the AUTS2 protein (p.His535_Thr542del), but otherwise preserves the integrity of the reading frame. (less)
Uncertain significance (Aug 04, 2020)	criteria provided, single submitter (Ambry Variant Classification Scheme 2023) Method: clinical testing	Inborn genetic diseases Affected status: unknown Allele origin: germline	Ambry Genetics Accession: SCV001444483.4 First in ClinVar: Nov 21, 2020 Last updated: May 01, 2024	Comment: The alteration results in an in-frame deletion:_x000D_ _x000D_ The c.1603_1626del24 (p.H535_T542del) alteration is located in coding exon 9 of the AUTS2 gene. This alteration results … (more) The alteration results in an in-frame deletion:_x000D_ _x000D_ The c.1603_1626del24 (p.H535_T542del) alteration is located in coding exon 9 of the AUTS2 gene. This alteration results from an in-frame deletion of 24 nucleotides at positions c.1603 to c.1626, resulting in the deletion of 8 amino acids at codons 535 to 542. The alteration is not observed in population databases:_x000D_ _x000D_ Based on data from the Genome Aggregation Database (gnomAD), the AUTS2 c.1603_1626del24 alteration was not observed, with coverage at this position The alteration is predicted deleterious by in silico models:_x000D_ _x000D_ The p.H535_T542del alteration is predicted to be deleterious with a score of -42.658 by PROVEAN in silico analysis. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. (less)
Likely pathogenic (Apr 03, 2020)	no assertion criteria provided Method: clinical testing	Neurodevelopmental abnormality Affected status: yes Allele origin: de novo	Department of Genetics, Rouen University Hospital, Normandy Center for Genomic and Personalized Medicine Accession: SCV001442889.1 First in ClinVar: Nov 12, 2020 Last updated: Nov 12, 2020	Sex: male
Likely pathogenic (May 02, 2024)	no assertion criteria provided Method: clinical testing	AUTS2-related condition Affected status: unknown Allele origin: germline	PreventionGenetics, part of Exact Sciences Accession: SCV005362519.1 First in ClinVar: Oct 08, 2024 Last updated: Oct 08, 2024	Comment: The AUTS2 c.1603_1626del24 variant is predicted to result in an in-frame deletion (p.His535_Thr542del). This variant was reported in two individuals with a neurodevelopmental disorder phenotype … (more) The AUTS2 c.1603_1626del24 variant is predicted to result in an in-frame deletion (p.His535_Thr542del). This variant was reported in two individuals with a neurodevelopmental disorder phenotype (Table S1, Sukenik-Halevy et al. 2022. PubMed ID: 35032046; de novo, Palumbo et al. 2021. PubMed ID: 33562463). At PreventionGenetics, we have also observed this variant to occur de novo in an individual with a neurodevelopmental disorder phenotype (internal data). This variant has not been reported in a large population database, indicating this variant is rare. This variant is interpreted as likely pathogenic. (less)

Comment:

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 984610). This variant has been observed in individual(s) with AUTS2 syndrome and/or clinical features of AUTS2-related conditions (PMID: 33562463, 35032046). In at least one individual the variant was observed to be de novo. This variant is not present in population databases (gnomAD no frequency). This variant, c.1603_1626del, results in the deletion of 8 amino acid(s) of the AUTS2 protein (p.His535_Thr542del), but otherwise preserves the integrity of the reading frame.

Comment:

The alteration results in an in-frame deletion:_x000D_ _x000D_ The c.1603_1626del24 (p.H535_T542del) alteration is located in coding exon 9 of the AUTS2 gene. This alteration results from an in-frame deletion of 24 nucleotides at positions c.1603 to c.1626, resulting in the deletion of 8 amino acids at codons 535 to 542. The alteration is not observed in population databases:_x000D_ _x000D_ Based on data from the Genome Aggregation Database (gnomAD), the AUTS2 c.1603_1626del24 alteration was not observed, with coverage at this position The alteration is predicted deleterious by in silico models:_x000D_ _x000D_ The p.H535_T542del alteration is predicted to be deleterious with a score of -42.658 by PROVEAN in silico analysis. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear.

Comment:

The AUTS2 c.1603_1626del24 variant is predicted to result in an in-frame deletion (p.His535_Thr542del). This variant was reported in two individuals with a neurodevelopmental disorder phenotype (Table S1, Sukenik-Halevy et al. 2022. PubMed ID: 35032046; de novo, Palumbo et al. 2021. PubMed ID: 33562463). At PreventionGenetics, we have also observed this variant to occur de novo in an individual with a neurodevelopmental disorder phenotype (internal data). This variant has not been reported in a large population database, indicating this variant is rare. This variant is interpreted as likely pathogenic.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
The prevalence of prenatal sonographic findings in postnatal diagnostic exome sequencing performed for neurocognitive phenotypes: A cohort study.	Sukenik-Halevy R	Prenatal diagnosis	2022	PMID: 35032046
Whole Exome Sequencing Reveals a Novel AUTS2 In-Frame Deletion in a Boy with Global Developmental Delay, Absent Speech, Dysmorphic Features, and Cerebral Anomalies.	Palumbo P	Genes	2021	PMID: 33562463

Text-mined citations for rs1789934246 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 13, 2024

ClinVar Genomic variation as it relates to human health

NM_015570.4(AUTS2):c.1603_1626del (p.531HQHT[1])

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs1789934246 ...