ClinVar for Gene (Select 3858) - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 100 of 202

<< First< Prev

Page of 3

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 3255318	I107T	KRT10	Single nucleotide variant	Ichthyosis, annular epidermolytic 1	GPathogenic
Select item 3255317	KRT10, 3-BP DEL, 1334AAT	KRT10	Deletion	not provided	GUncertain significance
Select item 3255316	KRT10, LEU435PRO	KRT10	Single nucleotide variant	Porcupine man	GPathogenic
Select item 3116305	NM_000421.5(KRT10):c.1541G>C (p.Gly514Ala)	KRT10 (G514A)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 3116304	NM_000421.5(KRT10):c.1541G>A (p.Gly514Glu)	KRT10 (G514E)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 3060207	NM_000421.5(KRT10):c.1606GGC[5] (p.Gly541del)	KRT10 (G541del)	Microsatellite (inframe deletion)	KRT10-related disorder	GBenign
Select item 3056687	NM_000421.5(KRT10):c.1623C>A (p.Gly541=)	KRT10	Single nucleotide variant (synonymous variant)	KRT10-related disorder	GLikely benign
Select item 3055364	NM_000421.5(KRT10):c.1459_1494del (p.His487_Gly498del)	KRT10	Deletion (inframe deletion)	KRT10-related disorder	GLikely benign
Select item 3053465	NM_000421.5(KRT10):c.1629_1643del (p.543GGGSS[1])	KRT10	Deletion (inframe deletion)	KRT10-related disorder	GBenign
Select item 3052674	NM_000421.5(KRT10):c.1606GGC[3] (p.Gly539_Gly541del)	KRT10	Microsatellite (inframe deletion)	KRT10-related disorder	GBenign
Select item 3050459	NM_000421.5(KRT10):c.1443_1445del (p.Ser483del)	KRT10 (S483del)	Deletion (inframe deletion)	KRT10-related disorder	GLikely benign
Select item 3049296	NM_000421.5(KRT10):c.1448_1459del (p.Ser483_His487delinsTyr)	KRT10	Deletion (inframe_indel)	KRT10-related disorder	GLikely benign
Select item 3043890	NM_000421.5(KRT10):c.1625A>C (p.Tyr542Ser)	KRT10 (Y542S)	Single nucleotide variant (missense variant)	KRT10-related disorder	GBenign
Select item 3041949	NM_000421.5(KRT10):c.1528G>A (p.Gly510Ser)	KRT10 (G510S)	Single nucleotide variant (missense variant)	KRT10-related disorder	GLikely benign
Select item 3040521	NM_000421.5(KRT10):c.1156-4T>G	KRT10, KRT10-AS1 +1 more	Single nucleotide variant (intron variant)	KRT10-related disorder	GLikely benign
Select item 3035570	NM_000421.5(KRT10):c.36T>C (p.Ser12=)	KRT10, KRT10-AS1	Single nucleotide variant (synonymous variant)	KRT10-related disorder	GLikely benign
Select item 3020820	NM_000421.5(KRT10):c.710+15C>T	KRT10, KRT10-AS1	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 2994501	NM_000421.5(KRT10):c.1407C>T (p.Phe469=)	KRT10	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2987077	NM_000421.5(KRT10):c.1546GGAAGCTCCAGCGGCGGCCACGGCGGC[3] (p.Gly524_Ser525insGlySerSerSerGlyGlyHisGlyGlyGlySerSerSerGlyGlyHisGlyGly)	KRT10	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 2984059	NM_000421.5(KRT10):c.1687_1688delinsCC (p.Ser563Pro)	KRT10 (S563P)	Indel (missense variant)	not provided	GUncertain significance
Select item 2983785	NM_000421.5(KRT10):c.1399_1416dup (p.Gly472_Tyr473insGlySerPheGlyGlyGly)	KRT10	Duplication (inframe_insertion)	not provided	GUncertain significance
Select item 2977634	NM_000421.5(KRT10):c.1749-16del	KRT10	Deletion (intron variant)	not provided	GBenign
Select item 2976420	NM_000421.5(KRT10):c.514T>C (p.Tyr172His)	KRT10, KRT10-AS1 (Y172H)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2966914	NM_000421.5(KRT10):c.354TGGAGGCGGCTTTGG[1] (p.121GFGGG[1])	KRT10, KRT10-AS1	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 2965448	NM_000421.5(KRT10):c.1476C>A (p.Gly492=)	KRT10	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2962523	NM_000421.5(KRT10):c.867+16T>C	KRT10, KRT10-AS1 +1 more	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 2959533	NM_000421.5(KRT10):c.1389A>C (p.Gly463=)	KRT10, KRT10-AS1	Single nucleotide variant (non-coding transcript variant +1 more)	not provided	GLikely benign
Select item 2959532	NM_000421.5(KRT10):c.1391G>A (p.Arg464His)	KRT10 (R464H)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2959531	NM_000421.5(KRT10):c.1422C>A (p.Gly474=)	KRT10	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2912151	NM_000421.5(KRT10):c.1500A>C (p.Gly500=)	KRT10	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2909679	NM_000421.5(KRT10):c.935T>C (p.Val312Ala)	KRT10, KRT10-AS1 +1 more (V312A)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2908882	NM_000421.5(KRT10):c.1379G>A (p.Gly460Glu)	KRT10, KRT10-AS1 (G460E)	Single nucleotide variant (non-coding transcript variant +1 more)	not provided	GUncertain significance
Select item 2899240	NM_000421.5(KRT10):c.734G>A (p.Arg245His)	KRT10, KRT10-AS1 +1 more (R245H)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2897317	NM_000421.5(KRT10):c.1459_1460delinsTC (p.His487Ser)	KRT10 (H487S)	Indel (missense variant)	not provided	GUncertain significance
Select item 2887036	NM_000421.5(KRT10):c.1470C>T (p.Gly490=)	KRT10	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2887035	NM_000421.5(KRT10):c.1488C>A (p.Gly496=)	KRT10	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2827038	NM_000421.5(KRT10):c.107T>C (p.Ile36Thr)	KRT10, KRT10-AS1 (I36T)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2787839	NM_000421.5(KRT10):c.1749-16dup	KRT10	Duplication (intron variant)	not provided	GBenign
Select item 2766969	NM_000421.5(KRT10):c.1528_1554dup (p.Ser518_Ser519insGlyGlyGlyTyrGlyGlyGlySerSer)	KRT10	Duplication (inframe_insertion)	KRT10-related disorder +1 more	GConflicting classifications of pathogenicity
Select item 2756212	NM_000421.5(KRT10):c.465C>A (p.Asp155Glu)	KRT10, KRT10-AS1 (D155E)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2752552	NM_000421.5(KRT10):c.462T>G (p.Asn154Lys)	KRT10, KRT10-AS1 (N154K)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2738068	NM_000421.5(KRT10):c.49GGA[6] (p.Gly23_Gly24del)	KRT10, KRT10-AS1	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 2721340	NM_000421.5(KRT10):c.742G>A (p.Val248Met)	KRT10, KRT10-AS1 +1 more (V248M)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2717357	NM_000421.5(KRT10):c.1448C>A (p.Ser483Tyr)	KRT10 (S483Y)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2714751	NM_000421.5(KRT10):c.1506AAGCTCCGGCGGCGG[4] (p.Gly512_Tyr513insSerSerGlyGlyGlySerSerGlyGlyGly)	KRT10	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 2713301	NM_000421.5(KRT10):c.371G>T (p.Gly124Val)	KRT10, KRT10-AS1 (G124V)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2702600	NM_000421.5(KRT10):c.1482T>C (p.Ser494=)	KRT10	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2689337	NM_000421.5(KRT10):c.1029+5_1029+9del	KRT10, KRT10-AS1 +1 more	Deletion (splice donor variant)	not provided	GUncertain significance
Select item 2647748	NM_000421.5(KRT10):c.1559G>T (p.Gly520Val)	KRT10 (G520V)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2647747	NM_000421.5(KRT10):c.1560C>T (p.Gly520=)	KRT10	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2633578	NM_000421.5(KRT10):c.458T>C (p.Leu153Pro)	KRT10, KRT10-AS1 (L153P)	Single nucleotide variant (missense variant)	KRT10-related disorder	GUncertain significance
Select item 2554203	NM_000421.5(KRT10):c.38C>T (p.Ser13Phe)	KRT10, KRT10-AS1 (S13F)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2546490	NM_000421.5(KRT10):c.1285A>G (p.Asn429Asp)	KRT10, KRT10-AS1 (N429D)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2534226	NM_000421.5(KRT10):c.1288A>G (p.Thr430Ala)	KRT10, KRT10-AS1 (T430A)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GLikely benign
Select item 2531447	NM_000421.5(KRT10):c.997C>T (p.Arg333Cys)	KRT10, KRT10-AS1 +1 more (R333C)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2525404	NM_000421.5(KRT10):c.1547G>A (p.Gly516Glu)	KRT10 (G516E)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2501706	NM_000421.5(KRT10):c.546T>A (p.Tyr182Ter)	KRT10, KRT10-AS1 (Y182*)	Single nucleotide variant (nonsense)	Epidermolytic ichthyosis	GLikely pathogenic
Select item 2500052	NM_000421.5(KRT10):c.1749-10A>G	KRT10	Single nucleotide variant (intron variant)	Epidermolytic ichthyosis +3 more	GLikely benign
Select item 2431374	NM_000421.5(KRT10):c.1374-1G>A	KRT10, KRT10-AS1	Single nucleotide variant (non-coding transcript variant +1 more)	Congenital reticular ichthyosiform erythroderma +1 more	GLikely pathogenic
Select item 2387533	NM_000421.5(KRT10):c.1468G>C (p.Gly490Arg)	KRT10 (G490R)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2356746	NM_000421.5(KRT10):c.1537T>C (p.Tyr513His)	KRT10 (Y513H)	Single nucleotide variant (missense variant)	Inborn genetic diseases +1 more	GConflicting classifications of pathogenicity
Select item 2356661	NM_000421.5(KRT10):c.1703C>T (p.Ser568Phe)	KRT10 (S568F)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2277817	NM_000421.5(KRT10):c.1225G>A (p.Ala409Thr)	KRT10, KRT10-AS1 +1 more (A409T)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2270826	NM_000421.5(KRT10):c.322G>A (p.Gly108Arg)	KRT10, KRT10-AS1 (G108R)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2261172	NM_000421.5(KRT10):c.1469G>C (p.Gly490Ala)	KRT10 (G490A)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2259326	NM_000421.5(KRT10):c.1622G>T (p.Gly541Val)	KRT10 (G541V)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2185618	NM_000421.5(KRT10):c.1536C>T (p.Gly512=)	KRT10	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2181729	NM_000421.5(KRT10):c.1209G>C (p.Gln403His)	KRT10, KRT10-AS1 +1 more (Q403H)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2155917	NM_000421.5(KRT10):c.1460A>G (p.His487Arg)	KRT10 (H487R)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2154854	NM_000421.5(KRT10):c.97T>A (p.Ser33Thr)	KRT10, KRT10-AS1 (S33T)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2151211	NM_000421.5(KRT10):c.1675_1676insCAGGCAGCAGCTCCGGCGGCGGATACGGCG (p.Gly558_Gly559insAlaGlySerSerSerGlyGlyGlyTyrGly)	KRT10	Insertion (inframe_insertion)	not provided	GLikely benign
Select item 2084433	NM_000421.5(KRT10):c.789C>T (p.Thr263=)	KRT10, KRT10-AS1 +1 more	Single nucleotide variant (synonymous variant)	not provided	GBenign/Likely benign
Select item 2084352	NM_000421.5(KRT10):c.321C>T (p.Phe107=)	KRT10, KRT10-AS1	Single nucleotide variant (synonymous variant)	not provided	GBenign/Likely benign
Select item 2059576	NM_000421.5(KRT10):c.305T>C (p.Phe102Ser)	KRT10, KRT10-AS1 (F102S)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 2059575	NM_000421.5(KRT10):c.1564_1587del (p.His522_Gly529del)	KRT10	Deletion (inframe_deletion)	not provided	GBenign
Select item 2054668	NM_000421.5(KRT10):c.1495T>C (p.Tyr499His)	KRT10 (Y499H)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 2048369	NM_000421.5(KRT10):c.1418A>C (p.Tyr473Ser)	KRT10 (Y473S)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 2047075	NM_000421.5(KRT10):c.1506AAGCTCCGGCGGCGG[3] (p.Gly512_Tyr513insSerSerGlyGlyGly)	KRT10	Microsatellite (inframe_insertion)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 2002339	NM_000421.5(KRT10):c.657C>A (p.Asn219Lys)	KRT10, KRT10-AS1 (N219K)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1965147	NM_000421.5(KRT10):c.201T>A (p.Phe67Leu)	KRT10, KRT10-AS1 (F67L)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1940497	NM_000421.5(KRT10):c.1634G>A (p.Gly545Asp)	KRT10 (G545D)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1705574	NM_000421.5(KRT10):c.470T>G (p.Leu157Arg)	KRT10, KRT10-AS1 (L157R)	Single nucleotide variant (missense variant)	Annular epidermolytic ichthyosis	GLikely pathogenic
Select item 1695527	NM_000421.5(KRT10):c.1588T>C (p.Tyr530His)	KRT10 (Y530H)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1659056	NM_000421.5(KRT10):c.312G>A (p.Gly104=)	KRT10, KRT10-AS1	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 1649350	NM_000421.5(KRT10):c.1617C>T (p.Gly539=)	KRT10	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1634234	NM_000421.5(KRT10):c.125C>T (p.Ser42Phe)	KRT10, KRT10-AS1 (S42F)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 1619765	NM_000421.5(KRT10):c.302= (p.Ile101=)	KRT10, KRT10-AS1	Variation (no sequence alteration)	not provided	GBenign
Select item 1615534	NM_000421.5(KRT10):c.129T>C (p.Leu43=)	KRT10, KRT10-AS1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1607474	NM_000421.5(KRT10):c.44G>A (p.Arg15His)	KRT10-AS1, KRT10 (R15H)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 1601794	NM_000421.5(KRT10):c.1640C>A (p.Ser547Tyr)	KRT10 (S547Y)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 1600527	NM_000421.5(KRT10):c.1524C>G (p.Ser508Arg)	KRT10 (S508R)	Single nucleotide variant (missense variant)	KRT10-related disorder +1 more	GBenign
Select item 1600017	NM_000421.5(KRT10):c.302T>G (p.Ile101Ser)	KRT10, KRT10-AS1 (I101S)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 1599263	NM_000421.5(KRT10):c.1468G>A (p.Gly490Ser)	KRT10 (G490S)	Single nucleotide variant (missense variant)	Inborn genetic diseases +1 more	GConflicting classifications of pathogenicity
Select item 1598575	NM_000421.5(KRT10):c.1724G>T (p.Gly575Val)	KRT10 (G575V)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 1596294	NM_000421.5(KRT10):c.1597G>A (p.Gly533Ser)	KRT10 (G533S)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 1588947	NM_000421.5(KRT10):c.756C>T (p.Ile252=)	KRT10, KRT10-AS1 +1 more	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 1588825	NM_000421.5(KRT10):c.153G>T (p.Gly51=)	KRT10, KRT10-AS1	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 1583376	NM_000421.5(KRT10):c.1528GGC[4] (p.Gly512dup)	KRT10	Microsatellite (inframe_insertion)	not provided	GLikely benign
Select item 1581336	NM_000421.5(KRT10):c.1520_1521insCTACGGGGGCGG (p.Gly507_Ser508insTyrGlyGlyGly)	KRT10	Insertion (inframe_insertion)	KRT10-related disorder +1 more	GBenign/Likely benign
Select item 1569698	NM_000421.5(KRT10):c.1629G>C (p.Gly543=)	KRT10	Single nucleotide variant (synonymous variant)	not provided	GLikely benign

<< First< Prev

Page of 3