ClinVar for MedGen (Select 1648347) - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Links from MedGen

Items: 18

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 3068039	NM_004544.4(NDUFA10):c.844C>T (p.Pro282Ser)	NDUFA10 (P282S)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 2671953	NM_004544.4(NDUFA10):c.1000-12409C>G	NDUFA10 (R356G)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 2671932	NM_004544.4(NDUFA10):c.1000-12367C>G	NDUFA10 (R370G)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 2434080	NM_004544.4(NDUFA10):c.1025_1026insATGG (p.Tyr343fs)	NDUFA10 (G306fs +1 more)	Insertion (frameshift variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 2413144	NM_004544.4(NDUFA10):c.557A>C (p.His186Pro)	NDUFA10 (H186P)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 1806358	NM_004544.4(NDUFA10):c.1000-12427TCCCTCCTTGAAGCTGATCGT[2]	NDUFA10	Microsatellite (inframe_deletion +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 1400345	NM_004544.4(NDUFA10):c.976C>T (p.Arg326Cys)	NDUFA10 (R326C)	Single nucleotide variant (missense variant +2 more)	Mitochondrial complex 1 deficiency, nuclear type 22 +2 more	GUncertain significance
Select item 1342399	NM_004544.4(NDUFA10):c.590A>G (p.Asp197Gly)	NDUFA10 (D197G)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 632354	NM_004544.4(NDUFA10):c.604dup (p.His202fs)	NDUFA10 (H202fs)	Duplication (frameshift variant +1 more)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 372195	NM_004544.4(NDUFA10):c.384_385insAAT (p.Ser128_Tyr129insAsn)	NDUFA10	Insertion (inframe_insertion +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GPathogenic
Select item 372194	NM_004544.4(NDUFA10):c.881T>C (p.Leu294Pro)	NDUFA10 (L294P)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GPathogenic
Select item 214708	NM_004544.4(NDUFA10):c.404T>C (p.Leu135Ser)	NDUFA10 (L135S)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex I deficiency, nuclear type 1 +3 more	GConflicting classifications of pathogenicity
Select item 214702	NM_004544.4(NDUFA10):c.1000-5del	NDUFA10	Deletion (intron variant)	not provided +3 more	GBenign/Likely benign
Select item 138437	NM_004544.4(NDUFA10):c.712G>A (p.Glu238Lys)	NDUFA10 (E238K)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex I deficiency, nuclear type 1 +4 more	GBenign/Likely benign
Select item 129686	NM_004544.4(NDUFA10):c.771A>G (p.Gln257=)	NDUFA10	Single nucleotide variant (synonymous variant +1 more)	not provided +3 more	GBenign
Select item 129685	NM_004544.4(NDUFA10):c.105A>G (p.Lys35=)	NDUFA10	Single nucleotide variant (synonymous variant +1 more)	Mitochondrial complex I deficiency, nuclear type 1 +3 more	GBenign
Select item 30393	NM_004544.4(NDUFA10):c.425A>G (p.Gln142Arg)	NDUFA10 (Q142R)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GPathogenic
Select item 30392	NM_004544.4(NDUFA10):c.1A>G (p.Met1Val)	NDUFA10 (M1V)	Single nucleotide variant (missense variant +2 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GLikely pathogenic