VCV000155901.13 - ClinVar

NM_005357.4(LIPE):c.3203_3221del (p.Val1068fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(5)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic/Likely pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_005357.4(LIPE):c.3203_3221del (p.Val1068fs)

Variation ID: 155901 Accession: VCV000155901.13

Type and length

Deletion, 19 bp

Location

Cytogenetic: 19q13.2 19: 42401822-42401840 (GRCh38) [ NCBI UCSC ] 19: 42905974-42905992 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Oct 11, 2015	Oct 8, 2024	Dec 1, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_005357.4:c.3203_3221del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_005348.2:p.Val1068fs	frameshift
NM_005357.4:c.3203_3221del19 MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_005357.3:c.3203_3221del19
NC_000019.10:g.42401840_42401858del
NC_000019.9:g.42905992_42906010del
NG_034246.1:g.30587_30605del

... more HGVS ... less HGVS

Protein change

V1068fs

Other names

Canonical SPDI

NC_000019.10:42401821:CCCCCGCAGCCCCCGTCTACCCCCGCAGCCCCCGTCT:CCCCCGCAGCCCCCGTCT

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA170722 OMIM: 151750.0001 dbSNP: rs587777699 VarSome

Comment on variant

NCBI staff reviewed the sequence information reported in PubMed 24848981 Fig. 1A to determine the location of this allele on the current reference sequence.

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
LIPE		-	-	GRCh38 GRCh37	-	190
LIPE-AS1	-	-	-	GRCh38	-	231
LOC101930071	-	-	-	GRCh38	-	119

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
LIPE-related familial partial lipodystrophy	Pathogenic/Likely pathogenic (4)	criteria provided, multiple submitters, no conflicts	Dec 1, 2023	RCV000144035.20
LIPE-related disorder	Likely pathogenic (1)	no assertion criteria provided	Jun 20, 2024	RCV004755778.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (Jun 02, 2016)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Lipodystrophy, familial partial, type 6 Affected status: yes Allele origin: germline	Genetic Services Laboratory, University of Chicago Accession: SCV000595591.1 First in ClinVar: Oct 11, 2015 Last updated: Oct 11, 2015
Pathogenic (Mar 24, 2023)	criteria provided, single submitter (Mendelics Assertion Criteria 2017) Method: clinical testing	LIPE-related familial partial lipodystrophy Affected status: unknown Allele origin: unknown	Mendelics Accession: SCV001141099.2 First in ClinVar: Jan 09, 2020 Last updated: Mar 26, 2023
Likely pathogenic (Dec 01, 2023)	criteria provided, single submitter (LabCorp Variant Classification Summary - May 2015) Method: clinical testing	LIPE-related familial partial lipodystrophy Affected status: unknown Allele origin: germline	Women's Health and Genetics/Laboratory Corporation of America, LabCorp Accession: SCV004242082.1 First in ClinVar: Feb 04, 2024 Last updated: Feb 04, 2024	Publications: PubMed (3) PubMed: 32041611‚ 35460704‚ 24848981 Comment: Variant summary: LIPE c.3203_3221del19 (p.Val1068GlyfsX102) causes a frameshift which results in an extension of the protein and is not expected to undergo nonsense mediated decay. … (more) Variant summary: LIPE c.3203_3221del19 (p.Val1068GlyfsX102) causes a frameshift which results in an extension of the protein and is not expected to undergo nonsense mediated decay. The variant allele was found at a frequency of 0.00048 in 1479348 control chromosomes in the gnomAD database, including 1 homozygote. Notably, it is found at a frequency of 0.024 within individuals of Amish ancestry. c.3203_3221del19 has been reported in the literature in the homozygous state in four siblings with clinical features of LIPE-Related Familial Partial Lipodystrophy from an Old Order Amish family where the variant primarily segregated with the disease phenotype amongst a total of ten siblings (Albert_2014). The variant has also been reported either in the heterozygous state or as an uninformative genotype in at least two other individuals with low HDL cholesterol/dyslipidemia who underwent WES/multigene panel testing (e.g. Dron_2020, Dong_2022). These data indicate that the variant is very likely to be associated with disease. At least one publication reports experimental evidence evaluating an impact on protein function (Albert_2014). In vitro, the variant was not found to significantly affect mRNA expression, but resulted in reduced protein levels. Additionally, in subcutaneous abdominal adipocytes from homozygous individuals, no protein was detected and triglyceride lipase activity and cholesterol ester hydrolase activity were reduced compared to wild type individuals and heterozygous carriers. The following publications have been ascertained in the context of this evaluation (PMID: 24848981, 35460704, 32041611). Three submitters have cited clinical-significance assessments for this variant to ClinVar after 2014. All submitters classified the variant as pathogenic/likely pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic. (less)
Pathogenic (Jun 12, 2014)	no assertion criteria provided Method: literature only	LIPODYSTROPHY, FAMILIAL PARTIAL, TYPE 6 Affected status: not provided Allele origin: germline	OMIM Accession: SCV000188933.5 First in ClinVar: Sep 16, 2014 Last updated: Mar 10, 2024	Publications: PubMed (1) PubMed: 24848981 Comment on evidence: In 4 sibs from an Old Order Amish family with familial partial lipodystrophy type 6 (FPLD6; 615980), Albert et al. (2014) identified homozygosity for a … (more) In 4 sibs from an Old Order Amish family with familial partial lipodystrophy type 6 (FPLD6; 615980), Albert et al. (2014) identified homozygosity for a 19-bp deletion (c.2300_2318del) in exon 9 of the LIPE gene, causing a frameshift predicted to result in a premature termination codon (Val767GlyfsTer102). These 4 individuals had dyslipidemia, hepatic steatosis, systemic insulin resistance, type 2 diabetes, and evidence for redistribution of body fat. Evaluation of the 4 homozygous sibs as well as 3 heterozygous and 3 noncarrier sibs showed that carriers of the deletion had higher triglyceride and insulin levels and lower HDL cholesterol and serum adiponectin (ADPN; 605441) levels than did noncarriers. Among 2,738 participants in the Amish Complex Disease Research Program, there were 140 heterozygous carriers of the deletion, giving a 5.1% carrier rate among the Amish compared to 0.2% among non-Amish persons of European descent. Association analysis showed that heterozygous carriers had an increased risk of dyslipidemia, with elevated triglycerides and reduced levels of HDL cholesterol, hepatic steatosis, and systemic insulin resistance, as well as an increased risk of type 2 diabetes (T2D; 125853) that was 1.8 times that of noncarriers. QT-PCR analysis of extracts of abdominal subcutaneous adipose tissue showed that homozygotes had LIPE mRNA levels that were approximately 30% of those of controls, whereas heterozygotes had levels similar to those of controls. Western blot analysis of the adipose tissue extracts showed no detectable LIPE protein in homozygotes, with an approximately 50% reduction in heterozygotes compared to controls. Examination of adipose tissue from 2 of the DD sibs revealed small adipocytes, impaired lipolysis, insulin resistance, and inflammation. In addition, transcription factors responsive to PPARG (601487) and downstream target genes were downregulated in DD adipose tissue, altering the regulation of pathways influencing adipogenesis, insulin sensitivity, and lipid metabolism. (less)
Likely pathogenic (Jun 20, 2024)	no assertion criteria provided Method: clinical testing	LIPE-related condition Affected status: unknown Allele origin: germline	PreventionGenetics, part of Exact Sciences Accession: SCV005348211.1 First in ClinVar: Oct 08, 2024 Last updated: Oct 08, 2024	Comment: The LIPE c.3203_3221del19 variant is predicted to result in a frameshift and premature protein termination (p.Val1068Glyfs102). This variant has been reported in the homozygous state … (more) The LIPE c.3203_3221del19 variant is predicted to result in a frameshift and premature protein termination (p.Val1068Glyfs102). This variant has been reported in the homozygous state in four siblings from an Amish community with partial lipodystrophy (p.V767Gfs*102 in Albert et al. 2014. PubMed ID: 24848981). Albert et al. also found that heterozygous individuals did not display the same adipose-tissue dysfunction as homozygous individuals; however, they did present with a range of features including dyslipidemia, hepatic steatosis, and diabetes (Albert et al. 2014. PubMed ID: 24848981). In addition, other studies have suggested that this variant leads to an increased risk of hypertriglyceridemia and other types of dyslipidemia when found in the heterozygous state (Table S2 in Deshotels et al. 2022. PubMed ID: 36325899; Table S4 in Dron et al. 2020. PubMed ID: 32041611). Familial segregation data and biochemical studies support its pathogenicity (Albert et al. 2014. PubMed ID: 24848981). This variant is reported in 0.27% of alleles in individuals of Ashkenazi Jewish descent in gnomAD; however, the quality of the data at this position is questionable and should be interpreted with caution. Frameshift variants in LIPE are expected to be pathogenic. This variant is interpreted as likely pathogenic. (less)

Comment:

Variant summary: LIPE c.3203_3221del19 (p.Val1068GlyfsX102) causes a frameshift which results in an extension of the protein and is not expected to undergo nonsense mediated decay. The variant allele was found at a frequency of 0.00048 in 1479348 control chromosomes in the gnomAD database, including 1 homozygote. Notably, it is found at a frequency of 0.024 within individuals of Amish ancestry. c.3203_3221del19 has been reported in the literature in the homozygous state in four siblings with clinical features of LIPE-Related Familial Partial Lipodystrophy from an Old Order Amish family where the variant primarily segregated with the disease phenotype amongst a total of ten siblings (Albert_2014). The variant has also been reported either in the heterozygous state or as an uninformative genotype in at least two other individuals with low HDL cholesterol/dyslipidemia who underwent WES/multigene panel testing (e.g. Dron_2020, Dong_2022). These data indicate that the variant is very likely to be associated with disease. At least one publication reports experimental evidence evaluating an impact on protein function (Albert_2014). In vitro, the variant was not found to significantly affect mRNA expression, but resulted in reduced protein levels. Additionally, in subcutaneous abdominal adipocytes from homozygous individuals, no protein was detected and triglyceride lipase activity and cholesterol ester hydrolase activity were reduced compared to wild type individuals and heterozygous carriers. The following publications have been ascertained in the context of this evaluation (PMID: 24848981, 35460704, 32041611). Three submitters have cited clinical-significance assessments for this variant to ClinVar after 2014. All submitters classified the variant as pathogenic/likely pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic.

Comment:

The LIPE c.3203_3221del19 variant is predicted to result in a frameshift and premature protein termination (p.Val1068Glyfs*102). This variant has been reported in the homozygous state in four siblings from an Amish community with partial lipodystrophy (p.V767Gfs*102 in Albert et al. 2014. PubMed ID: 24848981). Albert et al. also found that heterozygous individuals did not display the same adipose-tissue dysfunction as homozygous individuals; however, they did present with a range of features including dyslipidemia, hepatic steatosis, and diabetes (Albert et al. 2014. PubMed ID: 24848981). In addition, other studies have suggested that this variant leads to an increased risk of hypertriglyceridemia and other types of dyslipidemia when found in the heterozygous state (Table S2 in Deshotels et al. 2022. PubMed ID: 36325899; Table S4 in Dron et al. 2020. PubMed ID: 32041611). Familial segregation data and biochemical studies support its pathogenicity (Albert et al. 2014. PubMed ID: 24848981). This variant is reported in 0.27% of alleles in individuals of Ashkenazi Jewish descent in gnomAD; however, the quality of the data at this position is questionable and should be interpreted with caution. Frameshift variants in LIPE are expected to be pathogenic. This variant is interpreted as likely pathogenic.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Whole-exome sequencing reveals damaging gene variants associated with hypoalphalipoproteinemia.	Dong W	Journal of lipid research	2022	PMID: 35460704
Six years' experience with LipidSeq: clinical and research learnings from a hybrid, targeted sequencing panel for dyslipidemias.	Dron JS	BMC medical genomics	2020	PMID: 32041611
Null mutation in hormone-sensitive lipase gene and risk of type 2 diabetes.	Albert JS	The New England journal of medicine	2014	PMID: 24848981

Text-mined citations for rs587777699 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 13, 2024

ClinVar Genomic variation as it relates to human health

NM_005357.4(LIPE):c.3203_3221del (p.Val1068fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs587777699 ...