Warning: The NCBI web site requires JavaScript to function. more...

dbVar

Database of genomic structural variation

nsv5674277

Organism: Homo sapiens

Study:nstd102 (Clinical Structural Variants)
Variant Type:insertion
Method Type:Multiple
Submitted on:GRCh37, GRCh38

Variant Calls:1
Validation:Not tested
Clinical Assertions: Yes
Region Size:1

Description:NM_007294.4(BRCA1):c.5027_5028insCTTTTTCTTTTTT
TTCTTTTNNNNNNNNNNGATCTCCTGACCTCGTGATCCGCCCGCCTCGGCCTCCCAAA
GTGCTGGGATTACAGGCGTGAGCCACCGCGCCCGGCCCACCACATCACTTT (p.Leu1676delinsPhePhePhePhePhePhePheXaaXaaXaaXaaIleSerTer) AND Hereditary breast ovarian cancer syndrome
Publication(s):ACMG Board of Directors et al. 2014, American College of Obstetricians and Gynecologists et al. 2009, American Society of Clinical Oncology et al. 2003, Berliner et al. 2007, Berliner et al. 2012, Berliner et al. 2021, Green et al. 2013, Kalia et al. 2016, Lu et al. 2014, Moyer et al. 2014, Nelson et al. 2013, Nelson et al. 2019, No authors et al. 2014, No authors et al. 2021, Petrucelli et al. 1998, Phillips et al. 2013, Robson et al. 2010, Robson et al. 2015, Saslow et al. 2007, Stratton et al. 2008, Trepanier et al. 2004, US Preventive Services Task Force et al. 2019

Links to Other Resources

Source: NCBI

Genome View
Variant Region Details and Evidence
Validation Information
Clinical Assertions
Genotype Information

Genome View

Select assembly:

Overlapping variant regions from other studies: 140 SVs from 26 studies. See in: genome view

Submitted genomic43,067,654-43,067,654

Variant Region Placement Information

Variant Region ID	Placement Type	Assembly	Assembly Unit	Sequence ID	Chr	Start	Stop
nsv5674277	Submitted genomic	GRCh38 (hg38)	Primary Assembly	NC_000017.11	Chr17	43,067,654	43,067,654
nsv5674277	Submitted genomic	GRCh37 (hg19)	Primary Assembly	NC_000017.10	Chr17	41,219,671	41,219,671

Variant Call Information

Variant Call ID	Type	Method	Analysis	Subject Phenotype	Clinical Interpretation	Source of Interpretation	ClinVar ID
nssv17171586	insertion	Multiple	Multiple	BRCA1- and BRCA2-Associated Hereditary Breast and Ovarian Cancer; Breast-ovarian cancer, familial, susceptibility to; Hereditary Breast and Ovarian Cancer Syndrome; Hereditary breast and ovarian cancer syndrome; Hereditary breast and ovarian cancer syndrome	Pathogenic	ClinVar	RCV001385725.5, VCV001072881.6

Variant Call Placement Information

Variant Call ID	Placement Type	HGVS	Assembly	Sequence ID	Chr	Start	Stop
nssv17171586	Submitted genomic	NC_000017.11:g.430 67654_43067655ins1 22	GRCh38 (hg38)	NC_000017.11	Chr17	43,067,654	43,067,654
nssv17171586	Submitted genomic	NC_000017.10:g.412 19671_41219672ins1 22	GRCh37 (hg19)	NC_000017.10	Chr17	41,219,671	41,219,671

No validation data were submitted for this variant

Clinical Assertions

Variant Call ID	HGVS	Type	Allele Origin	Subject Phenotype	Clinical Interpretation	Source of Interpretation	ClinVar ID
nssv17171586	GRCh37: NC_000017.10:g.41219671_41219672ins122, GRCh38: NC_000017.11:g.43067654_43067655ins122	insertion	germline	BRCA1- and BRCA2-Associated Hereditary Breast and Ovarian Cancer; Breast-ovarian cancer, familial, susceptibility to; Hereditary Breast and Ovarian Cancer Syndrome; Hereditary breast and ovarian cancer syndrome; Hereditary breast and ovarian cancer syndrome	Pathogenic	ClinVar	RCV001385725.5, VCV001072881.6

No genotype data were submitted for this variant

You are here: NCBI