nsv5674277
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_007294.4(BRCA1):c.5027_5028insCTTTTTCTTTTTT
TTCTTTTNNNNNNNNNNGATCTCCTGACCTCGTGATCCGCCCGCCTCGGCCTCCCAAA
GTGCTGGGATTACAGGCGTGAGCCACCGCGCCCGGCCCACCACATCACTTT (p.Leu1676delinsPhePhePhePhePhePhePheXaaXaaXaaXaaIleSerTer) AND Hereditary breast ovarian cancer syndrome - Publication(s):ACMG Board of Directors et al. 2014, American College of Obstetricians and Gynecologists et al. 2009, American Society of Clinical Oncology et al. 2003, Berliner et al. 2007, Berliner et al. 2012, Berliner et al. 2021, Green et al. 2013, Kalia et al. 2016, Lu et al. 2014, Moyer et al. 2014, Nelson et al. 2013, Nelson et al. 2019, No authors et al. 2014, No authors et al. 2021, Petrucelli et al. 1998, Phillips et al. 2013, Robson et al. 2010, Robson et al. 2015, Saslow et al. 2007, Stratton et al. 2008, Trepanier et al. 2004, US Preventive Services Task Force et al. 2019
- ClinVar: RCV001385725.5
- ClinVar: VCV001072881.6
- GeneReviews: NBK1247
- MONDO: 0003582
- MeSH: D061325
- MedGen: C0677776
- OMIM: PS604370
- Orphanet: 145
- PubMed: 12692171
- PubMed: 15604628
- PubMed: 17392385
- PubMed: 17508274
- PubMed: 18163131
- PubMed: 19305347
- PubMed: 20065170
- PubMed: 20301425
- PubMed: 23188549
- PubMed: 23788249
- PubMed: 23918944
- PubMed: 24366376
- PubMed: 24366402
- PubMed: 24432435
- PubMed: 24493721
- PubMed: 25356965
- PubMed: 26324357
- PubMed: 26389258
- PubMed: 27854360
- PubMed: 31429903
- PubMed: 31479213
- PubMed: 33410258
- Overlapping Genes
Source: NCBI
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 140 SVs from 26 studies. See in: genome view
Overlapping variant regions from other studies: 140 SVs from 26 studies. See in: genome view
Variant Region Placement Information
Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
---|---|---|---|---|---|---|---|
nsv5674277 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000017.11 | Chr17 | 43,067,654 | 43,067,654 |
nsv5674277 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000017.10 | Chr17 | 41,219,671 | 41,219,671 |
Variant Call Information
Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
---|---|---|---|---|---|---|---|
nssv17171586 | insertion | Multiple | Multiple | BRCA1- and BRCA2-Associated Hereditary Breast and Ovarian Cancer; Breast-ovarian cancer, familial, susceptibility to; Hereditary Breast and Ovarian Cancer Syndrome; Hereditary breast and ovarian cancer syndrome; Hereditary breast and ovarian cancer syndrome | Pathogenic | ClinVar | RCV001385725.5, VCV001072881.6 |
Variant Call Placement Information
Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
---|---|---|---|---|---|---|---|
nssv17171586 | Submitted genomic | NC_000017.11:g.430 67654_43067655ins1 22 | GRCh38 (hg38) | NC_000017.11 | Chr17 | 43,067,654 | 43,067,654 |
nssv17171586 | Submitted genomic | NC_000017.10:g.412 19671_41219672ins1 22 | GRCh37 (hg19) | NC_000017.10 | Chr17 | 41,219,671 | 41,219,671 |
No validation data were submitted for this variant
Clinical Assertions
Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
---|---|---|---|---|---|---|---|
nssv17171586 | GRCh37: NC_000017.10:g.41219671_41219672ins122, GRCh38: NC_000017.11:g.43067654_43067655ins122 | insertion | germline | BRCA1- and BRCA2-Associated Hereditary Breast and Ovarian Cancer; Breast-ovarian cancer, familial, susceptibility to; Hereditary Breast and Ovarian Cancer Syndrome; Hereditary breast and ovarian cancer syndrome; Hereditary breast and ovarian cancer syndrome | Pathogenic | ClinVar | RCV001385725.5, VCV001072881.6 |