Warning: The NCBI web site requires JavaScript to function. more...

dbVar

Database of genomic structural variation

nsv5980461

Organism: Homo sapiens

Study:nstd102 (Clinical Structural Variants)
Variant Type:insertion
Method Type:Multiple
Submitted on:GRCh37, GRCh38

Variant Calls:1
Validation:Not tested
Clinical Assertions: Yes
Region Size:1

Description:NM_004329.3(BMPR1A):c.230+11_230+12insTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTGTTTTTTTTTTTTTTTNNNNNNNNNNTGCTCCT
TGCCCTCGGGCCCCGCGGGGCCCGTCCGCTCCTCCAGCCGCTGCCTCCCGGGCGGCGC
TCGCCGGCGCGGCGGCAAAGACTGCATGTAAGTATTTT AND Juvenile polyposis syndrome
Publication(s):Larsen Haidle et al. 2003, Miller et al. 2022, No authors et al. 2020, No authors et al. 2021

Links to Other Resources

Source: NCBI

Genome View
Variant Region Details and Evidence
Validation Information
Clinical Assertions
Genotype Information

Genome View

Select assembly:

Overlapping variant regions from other studies: 116 SVs from 24 studies. See in: genome view

Submitted genomic86,890,219-86,890,219

Variant Region Placement Information

Variant Region ID	Placement Type	Assembly	Assembly Unit	Sequence ID	Chr	Start	Stop
nsv5980461	Submitted genomic	GRCh38 (hg38)	Primary Assembly	NC_000010.11	Chr10	86,890,219	86,890,219
nsv5980461	Submitted genomic	GRCh37 (hg19)	Primary Assembly	NC_000010.10	Chr10	88,649,976	88,649,976

Variant Call Information

Variant Call ID	Type	Method	Analysis	Subject Phenotype	Clinical Interpretation	Source of Interpretation	ClinVar ID
nssv17517528	insertion	Multiple	Multiple	JUVENILE POLYPOSIS SYNDROME; JPS; Juvenile Polyposis Syndrome; Juvenile polyposis syndrome; Juvenile polyposis syndrome	Likely benign	ClinVar	RCV001463162.5, VCV001129841.6

Variant Call Placement Information

Variant Call ID	Placement Type	HGVS	Assembly	Sequence ID	Chr	Start	Stop
nssv17517528	Submitted genomic	NC_000010.11:g.868 90219_86890220ins1 62	GRCh38 (hg38)	NC_000010.11	Chr10	86,890,219	86,890,219
nssv17517528	Submitted genomic	NC_000010.10:g.886 49976_88649977ins1 62	GRCh37 (hg19)	NC_000010.10	Chr10	88,649,976	88,649,976

No validation data were submitted for this variant

Clinical Assertions

Variant Call ID	HGVS	Type	Allele Origin	Subject Phenotype	Clinical Interpretation	Source of Interpretation	ClinVar ID
nssv17517528	GRCh37: NC_000010.10:g.88649976_88649977ins162, GRCh38: NC_000010.11:g.86890219_86890220ins162	insertion	germline	JUVENILE POLYPOSIS SYNDROME; JPS; Juvenile Polyposis Syndrome; Juvenile polyposis syndrome; Juvenile polyposis syndrome	Likely benign	ClinVar	RCV001463162.5, VCV001129841.6

No genotype data were submitted for this variant

You are here: NCBI