nsv7093550
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_000179.3(MSH6):c.4001+9_4001+10insCTAACTATA
ATGGAATTATAACTAACTGACCTTAAGTTTCAAAGAAACAGTAAAAGGGGAAGGGATG
ATGCACTATGAAAAAACAAAAAAACTTTTTTTTTTTTTTTT AND Hereditary nonpolyposis colorectal neoplasms
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 108 SVs from 18 studies. See in: genome view
Overlapping variant regions from other studies: 108 SVs from 18 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nsv7093550 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000002.12 | Chr2 | 47,806,660 | 47,806,660 |
| nsv7093550 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000002.11 | Chr2 | 48,033,799 | 48,033,799 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786062 | insertion | Multiple | Multiple | Colorectal Neoplasms, Hereditary Nonpolyposis; Hereditary nonpolyposis colon cancer | Uncertain significance | ClinVar | RCV002857873.1, VCV002023334.1 |
Variant Call Placement Information
| Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nssv18786062 | Submitted genomic | NC_000002.12:g.478 06660_47806661ins1 08 | GRCh38 (hg38) | NC_000002.12 | Chr2 | 47,806,660 | 47,806,660 |
| nssv18786062 | Submitted genomic | NC_000002.11:g.480 33799_48033800ins1 08 | GRCh37 (hg19) | NC_000002.11 | Chr2 | 48,033,799 | 48,033,799 |
No validation data were submitted for this variant
Clinical Assertions
| Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786062 | GRCh37: NC_000002.11:g.48033799_48033800ins108, GRCh38: NC_000002.12:g.47806660_47806661ins108 | insertion | germline | Colorectal Neoplasms, Hereditary Nonpolyposis; Hereditary nonpolyposis colon cancer | Uncertain significance | ClinVar | RCV002857873.1, VCV002023334.1 |