nsv7093569
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_004006.3(DMD):c.6986_6987insTATATGGATCACATA
TACTCATCAGTGATTGTTCAGTAGTGAGCTGTGGGTCCTGCAGGAGCCAGCCAGTCTC
CAA (p.Lys2329delinsAsnIleTrpIleThrTyrThrHisGlnTer) AND Duchenne muscular dystrophy - Publication(s):Achermann et al. 2001, American Academy of Pediatrics Section on Cardiology and Cardiac Surgery et al. 2005, Birnkrant et al. 2007, Birnkrant et al. 2010, Birnkrant et al. 2018, Birnkrant et al. 2018, Birnkrant et al. 2018, Bushby et al. 2009, Bushby et al. 2009, Darras et al. 2000, Gloss et al. 2016, Moxley et al. 2005
- ClinVar: RCV003025277.1
- ClinVar: VCV002120690.1
- GeneReviews: NBK1119
- MONDO: 0010679
- MedGen: C0013264
- OMIM: 310200
- Orphanet: 98896
- PubMed: 15642897
- PubMed: 16322188
- PubMed: 18079231
- PubMed: 19945913
- PubMed: 19945914
- PubMed: 20301298
- PubMed: 20301604
- PubMed: 20597083
- PubMed: 26833937
- PubMed: 29395989
- PubMed: 29395990
- PubMed: 29398641
- Overlapping Genes
Source: NCBI
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 236 SVs from 23 studies. See in: genome view
Overlapping variant regions from other studies: 236 SVs from 23 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nsv7093569 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000023.11 | ChrX | 31,875,299 | 31,875,299 |
| nsv7093569 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000023.10 | ChrX | 31,893,416 | 31,893,416 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786230 | insertion | Multiple | Multiple | Duchenne muscular dystrophy; Duchenne muscular dystrophy; Dystrophinopathies; MUSCULAR DYSTROPHY, DUCHENNE TYPE; DMD | Pathogenic | ClinVar | RCV003025277.1, VCV002120690.1 |
Variant Call Placement Information
| Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nssv18786230 | Submitted genomic | NC_000023.11:g.318 75299_31875300ins7 6 | GRCh38 (hg38) | NC_000023.11 | ChrX | 31,875,299 | 31,875,299 |
| nssv18786230 | Submitted genomic | NC_000023.10:g.318 93416_31893417ins7 6 | GRCh37 (hg19) | NC_000023.10 | ChrX | 31,893,416 | 31,893,416 |
No validation data were submitted for this variant
Clinical Assertions
| Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786230 | GRCh37: NC_000023.10:g.31893416_31893417ins76, GRCh38: NC_000023.11:g.31875299_31875300ins76 | insertion | germline | Duchenne muscular dystrophy; Duchenne muscular dystrophy; Dystrophinopathies; MUSCULAR DYSTROPHY, DUCHENNE TYPE; DMD | Pathogenic | ClinVar | RCV003025277.1, VCV002120690.1 |