nsv7093571
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_001034853.2(RPGR):c.2873_2874insGGATGGAGGAA
GGAGAAGGGGAAGGGGAGGATGGAGAAGGGGAGGGGGAAGAGGAGGAAGGAGAATGGG
AGGGGGA (p.Glu959fs) AND Ciliary dyskinesia - Publication(s):Zariwala et al. 2007
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 126 SVs from 20 studies. See in: genome view
Overlapping variant regions from other studies: 126 SVs from 20 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nsv7093571 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000023.11 | ChrX | 38,286,125 | 38,286,125 |
| nsv7093571 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000023.10 | ChrX | 38,145,378 | 38,145,378 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786110 | insertion | Multiple | Multiple | Ciliary dyskinesia; Primary ciliary dyskinesia; Primary ciliary dyskinesia | Pathogenic | ClinVar | RCV002829620.2, VCV002013703.1 |
Variant Call Placement Information
| Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nssv18786110 | Submitted genomic | NC_000023.11:g.382 86125_38286126ins7 6 | GRCh38 (hg38) | NC_000023.11 | ChrX | 38,286,125 | 38,286,125 |
| nssv18786110 | Submitted genomic | NC_000023.10:g.381 45378_38145379ins7 6 | GRCh37 (hg19) | NC_000023.10 | ChrX | 38,145,378 | 38,145,378 |
No validation data were submitted for this variant
Clinical Assertions
| Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786110 | GRCh37: NC_000023.10:g.38145378_38145379ins76, GRCh38: NC_000023.11:g.38286125_38286126ins76 | insertion | germline | Ciliary dyskinesia; Primary ciliary dyskinesia; Primary ciliary dyskinesia | Pathogenic | ClinVar | RCV002829620.2, VCV002013703.1 |