nsv7093593
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_000199.5(SGSH):c.794_795insAGGTGCGATAAATAAT
AGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGG (p.Asp265delinsGluGlyAlaIleAsnAsnArgMetArgGlnGluSerLysThrAspThrAlaThrTer) AND Mucopolysaccharidosis, MPS-III-A - Publication(s):Wagner et al. 2019
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 127 SVs from 22 studies. See in: genome view
Overlapping variant regions from other studies: 127 SVs from 22 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nsv7093593 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000017.11 | Chr17 | 80,212,225 | 80,212,225 |
| nsv7093593 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000017.10 | Chr17 | 78,186,024 | 78,186,024 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786234 | insertion | Multiple | Multiple | MUCOPOLYSACCHARIDOSIS, TYPE IIIA; MPS3A; Mucopolysaccharidosis Type III; Mucopolysaccharidosis type 3; Mucopolysaccharidosis, MPS-III-A; Sanfilippo syndrome type A; See individual phenotypes in OMIM allelic variants | Pathogenic | ClinVar | RCV003028363.1, VCV002097039.1 |
Variant Call Placement Information
| Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nssv18786234 | Submitted genomic | NC_000017.11:g.802 12225_80212226ins6 5 | GRCh38 (hg38) | NC_000017.11 | Chr17 | 80,212,225 | 80,212,225 |
| nssv18786234 | Submitted genomic | NC_000017.10:g.781 86024_78186025ins6 5 | GRCh37 (hg19) | NC_000017.10 | Chr17 | 78,186,024 | 78,186,024 |
No validation data were submitted for this variant
Clinical Assertions
| Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786234 | GRCh37: NC_000017.10:g.78186024_78186025ins65, GRCh38: NC_000017.11:g.80212225_80212226ins65 | insertion | germline | MUCOPOLYSACCHARIDOSIS, TYPE IIIA; MPS3A; Mucopolysaccharidosis Type III; Mucopolysaccharidosis type 3; Mucopolysaccharidosis, MPS-III-A; Sanfilippo syndrome type A; See individual phenotypes in OMIM allelic variants | Pathogenic | ClinVar | RCV003028363.1, VCV002097039.1 |